ID: 994231713

View in Genome Browser
Species Human (GRCh38)
Location 5:97315587-97315609
Sequence CTCCTTTAGCTGCTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994231706_994231713 20 Left 994231706 5:97315544-97315566 CCTCTAGTGAGTTGCGTGACAGG No data
Right 994231713 5:97315587-97315609 CTCCTTTAGCTGCTTGAGGAAGG No data
994231705_994231713 21 Left 994231705 5:97315543-97315565 CCCTCTAGTGAGTTGCGTGACAG No data
Right 994231713 5:97315587-97315609 CTCCTTTAGCTGCTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994231713 Original CRISPR CTCCTTTAGCTGCTTGAGGA AGG Intergenic
No off target data available for this crispr