ID: 994244579

View in Genome Browser
Species Human (GRCh38)
Location 5:97465761-97465783
Sequence CTGGAGCCCTTCAAGAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994244574_994244579 8 Left 994244574 5:97465730-97465752 CCAATCTCTTAATTGGATTACTG No data
Right 994244579 5:97465761-97465783 CTGGAGCCCTTCAAGAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994244579 Original CRISPR CTGGAGCCCTTCAAGAATCA AGG Intergenic
No off target data available for this crispr