ID: 994248595

View in Genome Browser
Species Human (GRCh38)
Location 5:97510363-97510385
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994248591_994248595 -4 Left 994248591 5:97510344-97510366 CCAAATATGGCCCCATGGCATAT No data
Right 994248595 5:97510363-97510385 ATATTGAATATTTTAATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr