ID: 994248596

View in Genome Browser
Species Human (GRCh38)
Location 5:97510388-97510410
Sequence GTTAGAGAAATGACAAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994248594_994248596 9 Left 994248594 5:97510356-97510378 CCATGGCATATTGAATATTTTAA 0: 10
1: 30
2: 57
3: 117
4: 604
Right 994248596 5:97510388-97510410 GTTAGAGAAATGACAAGTGCAGG No data
994248593_994248596 10 Left 994248593 5:97510355-97510377 CCCATGGCATATTGAATATTTTA No data
Right 994248596 5:97510388-97510410 GTTAGAGAAATGACAAGTGCAGG No data
994248591_994248596 21 Left 994248591 5:97510344-97510366 CCAAATATGGCCCCATGGCATAT No data
Right 994248596 5:97510388-97510410 GTTAGAGAAATGACAAGTGCAGG No data
994248592_994248596 11 Left 994248592 5:97510354-97510376 CCCCATGGCATATTGAATATTTT No data
Right 994248596 5:97510388-97510410 GTTAGAGAAATGACAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994248596 Original CRISPR GTTAGAGAAATGACAAGTGC AGG Intergenic
No off target data available for this crispr