ID: 994257279

View in Genome Browser
Species Human (GRCh38)
Location 5:97613767-97613789
Sequence ATTCCTTCCTGGGGGATCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994257271_994257279 29 Left 994257271 5:97613715-97613737 CCTAGAACACTTAACTCAATGCT No data
Right 994257279 5:97613767-97613789 ATTCCTTCCTGGGGGATCAGCGG No data
994257274_994257279 -10 Left 994257274 5:97613754-97613776 CCATTGTAGTCTTATTCCTTCCT No data
Right 994257279 5:97613767-97613789 ATTCCTTCCTGGGGGATCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994257279 Original CRISPR ATTCCTTCCTGGGGGATCAG CGG Intergenic
No off target data available for this crispr