ID: 994261602

View in Genome Browser
Species Human (GRCh38)
Location 5:97665774-97665796
Sequence CTGTGAGCAGAAATGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994261602_994261606 5 Left 994261602 5:97665774-97665796 CCAAGCTTCATTTCTGCTCACAG No data
Right 994261606 5:97665802-97665824 CTAACCTATTTTATAGGTATGGG No data
994261602_994261603 -1 Left 994261602 5:97665774-97665796 CCAAGCTTCATTTCTGCTCACAG No data
Right 994261603 5:97665796-97665818 GACTTCCTAACCTATTTTATAGG No data
994261602_994261605 4 Left 994261602 5:97665774-97665796 CCAAGCTTCATTTCTGCTCACAG No data
Right 994261605 5:97665801-97665823 CCTAACCTATTTTATAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994261602 Original CRISPR CTGTGAGCAGAAATGAAGCT TGG (reversed) Intergenic
No off target data available for this crispr