ID: 994263705

View in Genome Browser
Species Human (GRCh38)
Location 5:97689462-97689484
Sequence GGTCCACTCAAAAAAGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994263700_994263705 -3 Left 994263700 5:97689442-97689464 CCTGCTTCTTCAAAATAGATGGT No data
Right 994263705 5:97689462-97689484 GGTCCACTCAAAAAAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994263705 Original CRISPR GGTCCACTCAAAAAAGGGGG TGG Intergenic
No off target data available for this crispr