ID: 994269513

View in Genome Browser
Species Human (GRCh38)
Location 5:97760388-97760410
Sequence CTTTCTCCCACTACTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994269513_994269517 18 Left 994269513 5:97760388-97760410 CCTGCCTCAGTAGTGGGAGAAAG No data
Right 994269517 5:97760429-97760451 TGACCTGCATTTTCAGAGTTTGG No data
994269513_994269519 22 Left 994269513 5:97760388-97760410 CCTGCCTCAGTAGTGGGAGAAAG No data
Right 994269519 5:97760433-97760455 CTGCATTTTCAGAGTTTGGCAGG No data
994269513_994269520 23 Left 994269513 5:97760388-97760410 CCTGCCTCAGTAGTGGGAGAAAG No data
Right 994269520 5:97760434-97760456 TGCATTTTCAGAGTTTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994269513 Original CRISPR CTTTCTCCCACTACTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr