ID: 994273250

View in Genome Browser
Species Human (GRCh38)
Location 5:97807142-97807164
Sequence CTGTTTGCACAGGGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994273244_994273250 20 Left 994273244 5:97807099-97807121 CCTTACAGAGAGTATAAACAGTA No data
Right 994273250 5:97807142-97807164 CTGTTTGCACAGGGAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994273250 Original CRISPR CTGTTTGCACAGGGAGAGGG AGG Intergenic
No off target data available for this crispr