ID: 994275485

View in Genome Browser
Species Human (GRCh38)
Location 5:97832142-97832164
Sequence GGGGGGACAATGTTTAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994275475_994275485 7 Left 994275475 5:97832112-97832134 CCTGGAAGTATTTTATAGTTTCT No data
Right 994275485 5:97832142-97832164 GGGGGGACAATGTTTAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994275485 Original CRISPR GGGGGGACAATGTTTAAGCT TGG Intergenic
No off target data available for this crispr