ID: 994279110

View in Genome Browser
Species Human (GRCh38)
Location 5:97878754-97878776
Sequence TGGTTTAAGAAAATGGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994279106_994279110 11 Left 994279106 5:97878720-97878742 CCACTAAAAGTTAGATGGGAAGT No data
Right 994279110 5:97878754-97878776 TGGTTTAAGAAAATGGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994279110 Original CRISPR TGGTTTAAGAAAATGGAGCA CGG Intergenic
No off target data available for this crispr