ID: 994279719

View in Genome Browser
Species Human (GRCh38)
Location 5:97886584-97886606
Sequence GGTTGTACCCTGCAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994279719_994279728 21 Left 994279719 5:97886584-97886606 CCCTCCAACTGCAGGGTACAACC No data
Right 994279728 5:97886628-97886650 AGGCCAGTAGTGACCCCAGCTGG No data
994279719_994279722 -3 Left 994279719 5:97886584-97886606 CCCTCCAACTGCAGGGTACAACC No data
Right 994279722 5:97886604-97886626 ACCCATAGCCGCTCCTAAACTGG No data
994279719_994279725 1 Left 994279719 5:97886584-97886606 CCCTCCAACTGCAGGGTACAACC No data
Right 994279725 5:97886608-97886630 ATAGCCGCTCCTAAACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994279719 Original CRISPR GGTTGTACCCTGCAGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr