ID: 994281395

View in Genome Browser
Species Human (GRCh38)
Location 5:97907782-97907804
Sequence GCTTAAGCATGTGCACTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994281392_994281395 8 Left 994281392 5:97907751-97907773 CCTGATAAGATCTCAGGAGTTGG 0: 124
1: 276
2: 289
3: 244
4: 222
Right 994281395 5:97907782-97907804 GCTTAAGCATGTGCACTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994281395 Original CRISPR GCTTAAGCATGTGCACTAAG AGG Intergenic
No off target data available for this crispr