ID: 994287118

View in Genome Browser
Species Human (GRCh38)
Location 5:97982601-97982623
Sequence AGGGAGAGGCCATTGAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994287118_994287127 6 Left 994287118 5:97982601-97982623 CCAACATTCAATGGCCTCTCCCT No data
Right 994287127 5:97982630-97982652 TGAGGAAGCTTCCTGGCGCCAGG No data
994287118_994287128 7 Left 994287118 5:97982601-97982623 CCAACATTCAATGGCCTCTCCCT No data
Right 994287128 5:97982631-97982653 GAGGAAGCTTCCTGGCGCCAGGG No data
994287118_994287123 -1 Left 994287118 5:97982601-97982623 CCAACATTCAATGGCCTCTCCCT No data
Right 994287123 5:97982623-97982645 TCCCCTTTGAGGAAGCTTCCTGG No data
994287118_994287131 29 Left 994287118 5:97982601-97982623 CCAACATTCAATGGCCTCTCCCT No data
Right 994287131 5:97982653-97982675 GTGACAGAATGAGATGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994287118 Original CRISPR AGGGAGAGGCCATTGAATGT TGG (reversed) Intergenic
No off target data available for this crispr