ID: 994287780

View in Genome Browser
Species Human (GRCh38)
Location 5:97991294-97991316
Sequence TTTAAAAAGCTTGAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994287774_994287780 15 Left 994287774 5:97991256-97991278 CCCTGAACTTGAATTGAATTGCC No data
Right 994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG No data
994287777_994287780 -6 Left 994287777 5:97991277-97991299 CCTAGGAAGAATAATTTTTTAAA No data
Right 994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG No data
994287775_994287780 14 Left 994287775 5:97991257-97991279 CCTGAACTTGAATTGAATTGCCT No data
Right 994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994287780 Original CRISPR TTTAAAAAGCTTGAGAAGGA GGG Intergenic
No off target data available for this crispr