ID: 994291377

View in Genome Browser
Species Human (GRCh38)
Location 5:98032000-98032022
Sequence AGTTATCCACAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994291375_994291377 4 Left 994291375 5:98031973-98031995 CCAAGAGCTGTCTCTCAAAGGGA No data
Right 994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG No data
994291371_994291377 16 Left 994291371 5:98031961-98031983 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG No data
994291370_994291377 17 Left 994291370 5:98031960-98031982 CCCCAGTAACAGGCCAAGAGCTG No data
Right 994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG No data
994291368_994291377 25 Left 994291368 5:98031952-98031974 CCACCAAACCCCAGTAACAGGCC No data
Right 994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG No data
994291372_994291377 15 Left 994291372 5:98031962-98031984 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG No data
994291369_994291377 22 Left 994291369 5:98031955-98031977 CCAAACCCCAGTAACAGGCCAAG No data
Right 994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994291377 Original CRISPR AGTTATCCACAGAAGATGGC AGG Intergenic
No off target data available for this crispr