ID: 994298594

View in Genome Browser
Species Human (GRCh38)
Location 5:98119930-98119952
Sequence TGCTCTCTCGATTCTAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994298594_994298598 27 Left 994298594 5:98119930-98119952 CCAAGGCTAGAATCGAGAGAGCA No data
Right 994298598 5:98119980-98120002 CAACCAGTGCAAACTGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994298594 Original CRISPR TGCTCTCTCGATTCTAGCCT TGG (reversed) Intergenic