ID: 994303950

View in Genome Browser
Species Human (GRCh38)
Location 5:98180146-98180168
Sequence CAGTGTGGGGGTGTGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994303950_994303956 -10 Left 994303950 5:98180146-98180168 CCTCAGAACACACCCCCACACTG No data
Right 994303956 5:98180159-98180181 CCCCACACTGGGGAACCCGAAGG No data
994303950_994303962 25 Left 994303950 5:98180146-98180168 CCTCAGAACACACCCCCACACTG No data
Right 994303962 5:98180194-98180216 GAGAAGATTCTTATCTTACCTGG No data
994303950_994303959 3 Left 994303950 5:98180146-98180168 CCTCAGAACACACCCCCACACTG No data
Right 994303959 5:98180172-98180194 AACCCGAAGGTCTAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994303950 Original CRISPR CAGTGTGGGGGTGTGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr