ID: 994304534

View in Genome Browser
Species Human (GRCh38)
Location 5:98186959-98186981
Sequence TTGTTGATACATGATGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994304534_994304537 -3 Left 994304534 5:98186959-98186981 CCAGGCTCATCATGTATCAACAA No data
Right 994304537 5:98186979-98187001 CAAAGGTTGAGAAAGGCAAGTGG No data
994304534_994304536 -10 Left 994304534 5:98186959-98186981 CCAGGCTCATCATGTATCAACAA No data
Right 994304536 5:98186972-98186994 GTATCAACAAAGGTTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994304534 Original CRISPR TTGTTGATACATGATGAGCC TGG (reversed) Intergenic
No off target data available for this crispr