ID: 994304536

View in Genome Browser
Species Human (GRCh38)
Location 5:98186972-98186994
Sequence GTATCAACAAAGGTTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994304534_994304536 -10 Left 994304534 5:98186959-98186981 CCAGGCTCATCATGTATCAACAA No data
Right 994304536 5:98186972-98186994 GTATCAACAAAGGTTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994304536 Original CRISPR GTATCAACAAAGGTTGAGAA AGG Intergenic
No off target data available for this crispr