ID: 994309131

View in Genome Browser
Species Human (GRCh38)
Location 5:98246137-98246159
Sequence CTCCATCTACAGATGACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994309127_994309131 5 Left 994309127 5:98246109-98246131 CCACCCACTTCTACTCCTTCACA No data
Right 994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG No data
994309128_994309131 2 Left 994309128 5:98246112-98246134 CCCACTTCTACTCCTTCACACTT No data
Right 994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG No data
994309130_994309131 -10 Left 994309130 5:98246124-98246146 CCTTCACACTTCTCTCCATCTAC No data
Right 994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG No data
994309129_994309131 1 Left 994309129 5:98246113-98246135 CCACTTCTACTCCTTCACACTTC No data
Right 994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG No data
994309126_994309131 8 Left 994309126 5:98246106-98246128 CCACCACCCACTTCTACTCCTTC No data
Right 994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG No data
994309125_994309131 17 Left 994309125 5:98246097-98246119 CCAATTCTACCACCACCCACTTC No data
Right 994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994309131 Original CRISPR CTCCATCTACAGATGACCCA AGG Intergenic
No off target data available for this crispr