ID: 994311811

View in Genome Browser
Species Human (GRCh38)
Location 5:98281453-98281475
Sequence ATGTCAGACCAGATATTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994311811_994311812 8 Left 994311811 5:98281453-98281475 CCTCAAAATATCTGGTCTGACAT No data
Right 994311812 5:98281484-98281506 CAGCACACTGCCAGTTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994311811 Original CRISPR ATGTCAGACCAGATATTTTG AGG (reversed) Intergenic
No off target data available for this crispr