ID: 994320334

View in Genome Browser
Species Human (GRCh38)
Location 5:98387314-98387336
Sequence AGGGGAAGTGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994320334_994320342 30 Left 994320334 5:98387314-98387336 CCCACAATCACTGCACTTCCCCT No data
Right 994320342 5:98387367-98387389 TATACTGTGCAGCTGGGAGATGG No data
994320334_994320340 23 Left 994320334 5:98387314-98387336 CCCACAATCACTGCACTTCCCCT No data
Right 994320340 5:98387360-98387382 TCGGTGTTATACTGTGCAGCTGG No data
994320334_994320341 24 Left 994320334 5:98387314-98387336 CCCACAATCACTGCACTTCCCCT No data
Right 994320341 5:98387361-98387383 CGGTGTTATACTGTGCAGCTGGG No data
994320334_994320339 4 Left 994320334 5:98387314-98387336 CCCACAATCACTGCACTTCCCCT No data
Right 994320339 5:98387341-98387363 CAAGCACACAGATTCTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994320334 Original CRISPR AGGGGAAGTGCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr