ID: 994320789

View in Genome Browser
Species Human (GRCh38)
Location 5:98392419-98392441
Sequence CCCAGCAGGAGGACATAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994320789_994320802 19 Left 994320789 5:98392419-98392441 CCGCGCTATGTCCTCCTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 156
Right 994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG 0: 1
1: 0
2: 11
3: 24
4: 66
994320789_994320798 4 Left 994320789 5:98392419-98392441 CCGCGCTATGTCCTCCTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 156
Right 994320798 5:98392446-98392468 CTGCGGGGCAGCCTCCAGCTCGG 0: 1
1: 3
2: 13
3: 49
4: 333
994320789_994320800 15 Left 994320789 5:98392419-98392441 CCGCGCTATGTCCTCCTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 156
Right 994320800 5:98392457-98392479 CCTCCAGCTCGGACAGCTTGCGG 0: 1
1: 1
2: 1
3: 16
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994320789 Original CRISPR CCCAGCAGGAGGACATAGCG CGG (reversed) Intergenic
900368670 1:2321839-2321861 CCGAGCTGGAGGCCATAGCTGGG - Intronic
900685597 1:3945862-3945884 CCCAGCAGGACCCCATAGGGAGG - Intergenic
900998646 1:6136356-6136378 TCCTGCAGGAGGTCAAAGCGGGG + Intronic
901557288 1:10041725-10041747 TCCAGCATGGGGACACAGCGAGG - Intronic
906559721 1:46747498-46747520 GCCAGCATGAGCACCTAGCGTGG + Intergenic
907675020 1:56510168-56510190 CTCAGCAGGAGGACAGCCCGCGG - Intronic
911192362 1:94960542-94960564 CCCACCATGTGGACATAGCTTGG + Intergenic
911329512 1:96511042-96511064 CCCAGCAGCAGGAAATAGATAGG + Intergenic
914177073 1:145287663-145287685 CCCGGCAGGAGGACTGAGCAAGG - Intergenic
914300051 1:146369998-146370020 CCCAGCAGGACGACTGAGCAAGG - Intergenic
914636590 1:149558574-149558596 CCCAGCAGGACGACTGAGCAAGG + Intergenic
915299614 1:154944579-154944601 CCCAGCACGAGGACTTACCCTGG - Exonic
915895432 1:159808086-159808108 CCCAGCAGGAGGCCTTAGGCTGG + Intronic
916314251 1:163429894-163429916 CACAGCAGGAAGACAGAGCCAGG - Intergenic
920438447 1:205963081-205963103 CCCAGCAGGACGTCAGAGCTTGG - Intergenic
921101510 1:211932875-211932897 CCCAGCAGGAGGGCTTTGCCTGG - Intergenic
921332404 1:214052529-214052551 CCCAAAAGGAGGATATAGCGTGG - Intergenic
922853420 1:228754203-228754225 CTCAGATGGAGGACAGAGCGAGG + Intergenic
923835187 1:237603344-237603366 CCCAGCAAGGGGACAGAGTGGGG + Intronic
924903418 1:248426577-248426599 CTTAGGAGGAGGACTTAGCGAGG - Intergenic
1064130702 10:12707113-12707135 CCCAGCCCCAGGACATAGCCTGG + Intronic
1065375582 10:25037286-25037308 CCAATTAGGAGGACATAGCACGG + Intronic
1066506873 10:36054651-36054673 CCCATCAAGAGGACACAGTGAGG - Intergenic
1067045883 10:42984970-42984992 CCCAGGAGCAGGACCTTGCGTGG - Intergenic
1069053752 10:63822199-63822221 CCCACCAGAATGACATAGAGTGG - Intergenic
1075448904 10:122533737-122533759 CTCAGCAGGAGGCCATGGGGAGG + Intergenic
1076243314 10:128926837-128926859 CCCCGCAGCAGCACAGAGCGGGG - Intergenic
1076381671 10:130028035-130028057 CTCAGCAGGAGGGCCTGGCGAGG + Intergenic
1076388397 10:130076184-130076206 CTCACCAGGAGGACAAAGGGAGG + Intergenic
1080462890 11:32471206-32471228 CCAAGCAGCAGGACATTTCGGGG + Intergenic
1083793841 11:65003129-65003151 CACAGTAGCAGGACAGAGCGAGG - Intergenic
1083958184 11:65998486-65998508 CCCTGCATGAGGACAAAGCAGGG - Exonic
1084103514 11:66965699-66965721 CCCAGGAGGTGGAGATTGCGGGG - Intergenic
1085350726 11:75796541-75796563 CCCAGCAGGAGCACAGGGGGTGG - Intronic
1089358691 11:117872550-117872572 CGCAGCTGGAGGACAAAGCCAGG - Intronic
1090057980 11:123439587-123439609 CCCAGCTTGAGGACATACAGAGG - Intergenic
1090756779 11:129798631-129798653 CCCAGCACCAGCACATAGCCTGG + Intergenic
1091641579 12:2241199-2241221 GCCAGCGCGGGGACATAGCGGGG - Intronic
1091648537 12:2292047-2292069 ACCAGCAGGAGGACATCACTAGG + Intronic
1093646197 12:21587931-21587953 CCAGGTAGGAGGACATAGGGAGG + Intronic
1094820258 12:34219048-34219070 CCCTGAAGGAGGTCAAAGCGGGG + Intergenic
1098170707 12:67744113-67744135 CCCAGAAGGAGCACACAGCAGGG - Intergenic
1099559759 12:84156744-84156766 CTCAGGATGAGGACATAGCAAGG - Intergenic
1102221198 12:111195599-111195621 CCCAGCTCAAGGACAGAGCGTGG - Intronic
1103177989 12:118881088-118881110 CCCAGGAGGAAGACAGAGAGAGG - Intergenic
1104503701 12:129310513-129310535 CCCAGCAGGAGCTCAGAGGGAGG - Intronic
1104773352 12:131378577-131378599 CCGAGCAGGAGCACATATAGAGG + Intergenic
1105243612 13:18628703-18628725 CCAGGCAGCAGGACATAGCAAGG - Intergenic
1106670656 13:31901075-31901097 GCCAGCAGAAGGACTTAGCCTGG - Intergenic
1110715697 13:78701572-78701594 GGCAGCAGAAGGACATAGTGAGG - Intergenic
1113123194 13:106946947-106946969 TCCAGCAGGACGACCTAGGGTGG - Intergenic
1114740520 14:25092268-25092290 CCCAGAAGGAGGCCATGGCCTGG + Intergenic
1115718169 14:36128831-36128853 CCCAGCAGGAGATCAGAGGGTGG + Intergenic
1118226105 14:63900684-63900706 CCCAGGAGGAGGGAATAGAGTGG + Intronic
1120837878 14:89057384-89057406 CCCAGCATAAGGAGATAGAGAGG - Intergenic
1127719086 15:61682178-61682200 CCTAACAGGCGGACATAGCAAGG + Intergenic
1129255176 15:74330301-74330323 CCCAGCAGGAGGAGGAAGAGGGG + Exonic
1129257300 15:74340920-74340942 TCCAGGAAGAGGACCTAGCGTGG - Intronic
1130833329 15:87625439-87625461 CCCAGGAAGAGGACACAGAGTGG + Intergenic
1132717755 16:1300736-1300758 CCCAGCAGGAGGGCGTGGGGAGG - Intergenic
1134678109 16:16104744-16104766 CCGCGCAGGAGCCCATAGCGGGG + Intronic
1137403732 16:48174203-48174225 CCCAGCAGGAGCTCACAGTGTGG - Intronic
1137573344 16:49580908-49580930 CCCACCAGGAGGACAGCCCGAGG + Intronic
1138803530 16:60064356-60064378 CCCATCATGAGCACATAGTGAGG - Intergenic
1139362248 16:66407017-66407039 CCGAGCAGGAGGACGAGGCGTGG - Intergenic
1139634942 16:68252769-68252791 ACCAGCATGAGCACATAGTGTGG + Intronic
1141236896 16:82226872-82226894 CCCACCAGGAGGAACTAGCTAGG + Intergenic
1149681079 17:58507580-58507602 CCCAGCAGGAGAACAAGGCCTGG + Intronic
1150617735 17:66785111-66785133 CCCAGTGGGAGGACAGAGAGAGG - Intronic
1152119440 17:78409191-78409213 CCCAGCAGATGGACACAGCCTGG - Intronic
1154250664 18:12741640-12741662 CCCAGCAGGATGGCATGGCAAGG - Intergenic
1154445333 18:14431182-14431204 CCAGGCAGCAGGACATAGCAAGG + Intergenic
1158870436 18:61681927-61681949 CCCCGCAGGAAGACATGGCCAGG + Intergenic
1159943700 18:74427973-74427995 CCCAGCAGGAGCAAAGAGTGGGG + Intergenic
1160993584 19:1871749-1871771 TCCAACCGGAGGACACAGCGAGG + Intergenic
1161687781 19:5711916-5711938 CCCCGCAGGAAGTCAAAGCGGGG - Exonic
1162133256 19:8540207-8540229 CCAACCTGGAGGACAAAGCGAGG - Intronic
1162437182 19:10668275-10668297 CCCAGCAACAGGACATGGTGAGG - Intronic
1164744425 19:30600645-30600667 CCCCGGAGGAGGACATAGCCTGG + Intronic
1167643654 19:50694946-50694968 GCCAGCTGGAGGACAGCGCGGGG + Intronic
1168411949 19:56145892-56145914 GCCAGCAGGAGCACACAGCAAGG - Intronic
925657787 2:6167985-6168007 CCAAGCAGGAGCACAGAGCTGGG - Intergenic
927497079 2:23558170-23558192 CCCAGAAAGAGGACATACTGTGG + Intronic
929104729 2:38353486-38353508 CCCAGAAGGAGAACAAAGTGAGG + Intronic
930735445 2:54774020-54774042 GCCAGCAGGAGGAGAAAGAGGGG + Intronic
936029976 2:109063052-109063074 TCCAGCAGGTGGACAAGGCGAGG - Intergenic
937258146 2:120569056-120569078 CCCAGCAGGAGGGCTGAGTGGGG - Intergenic
938344403 2:130556957-130556979 ACCAGCAGCAGGACACAGAGGGG - Intergenic
938345430 2:130563765-130563787 ACCAGCAGCAGGACACAGAGGGG + Intergenic
939015398 2:136897667-136897689 CCAATCAGCAGGACATAGCCAGG - Intronic
945493677 2:210484301-210484323 CCCAGCTGGAGCACAGAGAGGGG + Intronic
946185108 2:217976386-217976408 CCCAGCAGGAGGAAAAGGCAGGG + Intronic
946466202 2:219914211-219914233 CCCAGCCAGAGGGCATAACGTGG - Intergenic
947728447 2:232415333-232415355 CCCAGCAGAAGGGCACAGCTGGG - Intergenic
948825865 2:240573257-240573279 CCCAGCAGGAGGCCCTACCTGGG - Exonic
948948327 2:241233175-241233197 CCCAGCAGGATGCCAGAGCCAGG + Intronic
1168953377 20:1817654-1817676 CACAGCAGGAGTACACAGAGGGG + Intergenic
1169147229 20:3260703-3260725 CCCAGGAGGCGGAGATAGCAGGG - Intronic
1170224485 20:13976648-13976670 CTCAGCAGGAGAACATAATGAGG + Intronic
1173418599 20:42880550-42880572 CCCAGCAGGAGGGCATCCTGGGG - Intronic
1174669269 20:52291421-52291443 CCCGGTAGGAGGAGATAGTGGGG + Intergenic
1175092997 20:56520198-56520220 CCCAGCAGGAGCACAGATCATGG - Intronic
1175965124 20:62656539-62656561 CCCAGCAGGAGGGCATCCCCGGG + Exonic
1178418403 21:32423144-32423166 CTCAGCAGGAAGACAGAGCAAGG - Intronic
1179191327 21:39124534-39124556 CCCAGCAGGAGGTCTCACCGTGG + Intergenic
1182380447 22:29883338-29883360 CCGGGCAGCAGGACATGGCGAGG - Exonic
1184788198 22:46682110-46682132 CCCAGGAGGAGGGCAGAGCTGGG - Intergenic
1184841416 22:47054528-47054550 ACCAGCAGATGGACATGGCGAGG - Intronic
950400935 3:12768869-12768891 CCCTGCAGGAGCCCATGGCGGGG + Intronic
951849643 3:27124805-27124827 CCCAGCAGGTGGAAATATGGAGG + Intronic
954126670 3:48535251-48535273 CCTAGCAGGAGGCCACAGGGAGG + Intronic
954629874 3:52041994-52042016 CCCAGCTGGAGGACAAGGTGAGG + Intergenic
954664741 3:52245818-52245840 ACCAGCCGGCGGACATGGCGCGG - Intronic
957504828 3:81106247-81106269 CCCAGCAGGAGCTCATGGCCTGG + Intergenic
958178651 3:90029011-90029033 CCCAGGAGGAGGAGGTTGCGGGG - Intergenic
961022773 3:123523142-123523164 CCCAGCTGGAGGACCCAGCAGGG + Intronic
961828798 3:129612730-129612752 GCCAGCAGGAGCACATGGGGCGG + Intergenic
962269115 3:133965219-133965241 CCCAGCAGGAAGCCATAACATGG + Intronic
967058748 3:185852862-185852884 CCCATCATGAGGCCATAGCAAGG + Intergenic
969922880 4:10557371-10557393 CCCAACAGGAGGTCACAGGGAGG + Intronic
970107032 4:12596179-12596201 TCCAGCAGGGGGACAGAGTGGGG + Intergenic
980786601 4:137564087-137564109 CCCAGCAGAACCACATAGAGAGG + Intergenic
981582931 4:146268741-146268763 CACAGCATCAGGACATAGCTGGG + Intronic
982284796 4:153724034-153724056 CACAGCAGAAGGAAATAGCCTGG - Intronic
983142381 4:164167654-164167676 GTCACCAGGAGGACATAGTGGGG + Intronic
994320789 5:98392419-98392441 CCCAGCAGGAGGACATAGCGCGG - Intergenic
995908682 5:117158794-117158816 AACAGAAGGAGGACATAGCATGG - Intergenic
996439403 5:123472616-123472638 CCCAGGAGGAGGACAGAGTTTGG - Intergenic
997468804 5:134105175-134105197 GCCAGCAGGGGGACAGAGCCTGG - Intergenic
1002071687 5:176682247-176682269 CCCATCTGGAGGGCATAGCTGGG - Intergenic
1008910719 6:56729512-56729534 CCCAGGAGGCGGAGATTGCGGGG + Intronic
1014805512 6:125824958-125824980 CCCAGGAGGCGGACATTGCAGGG + Intronic
1015558751 6:134492071-134492093 CAAAGCTGGAGGACATAGCCGGG + Intergenic
1016392178 6:143585529-143585551 CCAAGCAGGAGGCCATACTGTGG + Intronic
1017233748 6:152098781-152098803 TCCAGCAGCAGGTCATAGAGGGG - Exonic
1018885562 6:167933002-167933024 CCCAGCAGGATGAAATATCATGG - Intronic
1019289065 7:241146-241168 CCCAGCAGGAGGAAGCAGGGAGG - Intronic
1019443300 7:1058257-1058279 CCCAGCAGGATCAGATAGTGTGG - Exonic
1023107322 7:36775165-36775187 CCCAGTAGGAGTGCATAGGGAGG - Intergenic
1024007700 7:45239522-45239544 CCCAGCAGCAAGACACAGCTGGG - Intergenic
1024716891 7:52088788-52088810 CCCTGCAGCAGGACATCGCAGGG - Intergenic
1025250354 7:57347571-57347593 CCCAGGAGGAGGGCACAGCAGGG + Intergenic
1025287409 7:57676006-57676028 CCCAGGAGGAGGAGATTGCAGGG + Intergenic
1025712540 7:63926213-63926235 CCCTGGAGGGAGACATAGCGCGG + Intergenic
1026441923 7:70452516-70452538 ACCAGCAGGAGGAAACAGGGTGG - Intronic
1034891146 7:154840259-154840281 CCCAGCAGGTGGCCATGGCGAGG + Intronic
1035681040 8:1488288-1488310 CACAGCAGGAGGACGCAGCGGGG + Intergenic
1037390090 8:18384290-18384312 TCCAGCAGGAGGGCAGAGAGAGG - Intergenic
1040703161 8:50092181-50092203 CCTGGAAGGAGGACATAGCAGGG + Intronic
1049741112 8:144241450-144241472 CCCAGCTGGAGGACTTCGTGAGG + Exonic
1055533824 9:77215738-77215760 CCTTGTTGGAGGACATAGCGTGG + Intronic
1056726059 9:89118782-89118804 CCCAGTAGGAGGGCAAAGCGAGG + Intronic
1058607234 9:106735928-106735950 CCCAGAAGGAGGGCACAGCAGGG + Intergenic
1058737335 9:107905773-107905795 CCCAGCAGGGGGACAAAGAGAGG - Intergenic
1059626168 9:116068853-116068875 CCCAGAAGGAAGACATAGAAAGG + Intergenic
1060423785 9:123488035-123488057 CCCAGCAGGAGGACACCCTGTGG - Intronic
1061932949 9:133842737-133842759 CCCAGGCGGAGGCCATAGTGAGG + Intronic
1062064549 9:134519175-134519197 CCAAGCAGGATGACATTGCCGGG + Intergenic
1062209976 9:135358291-135358313 CGCAGCAGGAGGACCCAGCCAGG + Intergenic
1062399697 9:136366989-136367011 CCCAGCAGACGGACATTGGGCGG + Intronic
1189288424 X:39868202-39868224 CCCAGCAGGATGCCATGGTGAGG - Intergenic
1199222402 X:145333072-145333094 CCCAGCATCAGGAAATAGTGTGG - Intergenic
1200048609 X:153416259-153416281 CCTAGCAGTGGGACATAGGGTGG - Intergenic