ID: 994320793

View in Genome Browser
Species Human (GRCh38)
Location 5:98392430-98392452
Sequence CCCGCAGCCGGCCCAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 340}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994320793_994320803 20 Left 994320793 5:98392430-98392452 CCTCCTGCTGGGCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 26
4: 340
Right 994320803 5:98392473-98392495 CTTGCGGTTGGCATCCTTAACGG 0: 1
1: 0
2: 9
3: 18
4: 55
994320793_994320800 4 Left 994320793 5:98392430-98392452 CCTCCTGCTGGGCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 26
4: 340
Right 994320800 5:98392457-98392479 CCTCCAGCTCGGACAGCTTGCGG 0: 1
1: 1
2: 1
3: 16
4: 124
994320793_994320802 8 Left 994320793 5:98392430-98392452 CCTCCTGCTGGGCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 26
4: 340
Right 994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG 0: 1
1: 0
2: 11
3: 24
4: 66
994320793_994320798 -7 Left 994320793 5:98392430-98392452 CCTCCTGCTGGGCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 26
4: 340
Right 994320798 5:98392446-98392468 CTGCGGGGCAGCCTCCAGCTCGG 0: 1
1: 3
2: 13
3: 49
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994320793 Original CRISPR CCCGCAGCCGGCCCAGCAGG AGG (reversed) Intergenic
900032639 1:382050-382072 GCCGCAGCCAGCACAGCAGCAGG + Intergenic
900053280 1:610670-610692 CCAGCAGGCGGCGCTGCAGGAGG + Intergenic
900053397 1:611112-611134 GCCGCAGCCAGCACAGCAGCAGG + Intergenic
900126703 1:1071991-1072013 CCTGCAGCGCGCCCAGCAGCGGG + Exonic
900147537 1:1164967-1164989 CCCAGAGCCGCCCCAGCAAGGGG - Intergenic
900226484 1:1535673-1535695 CCAGCAGCAGCCCCAGCATGAGG + Exonic
900364128 1:2303891-2303913 CGCACCGCCGGCCCAGCAGAAGG + Exonic
900627489 1:3615658-3615680 CCCGCACCCGGGCCTGCAAGAGG + Intergenic
901044594 1:6388222-6388244 CCTGCAGCCTCCCCAGCAGCTGG + Intronic
901157353 1:7149557-7149579 CCCCCAGCAGCCCCAGGAGGTGG - Intronic
901816078 1:11794282-11794304 CCCGCAGCCTGGCCTGCAGCTGG + Intronic
901929834 1:12590112-12590134 CCCGCAGCTTGCTCTGCAGGTGG - Intronic
902447839 1:16478391-16478413 CCTGCAGGTGGCCCAGCAGCAGG - Intergenic
902449310 1:16486514-16486536 CCTGCTGCAGGCCCAGCTGGAGG - Intergenic
902467739 1:16628604-16628626 CCTGCAGGTGGCCCAGCAGCAGG - Intergenic
902505438 1:16936763-16936785 CCTGCTGCAGGCCCAGCTGGAGG + Exonic
902506841 1:16944124-16944146 CCTGCAGGTGGCCCAGCAGCAGG + Exonic
902800576 1:18827079-18827101 CCAGCAGCCCTCCCAGCAGCTGG + Intergenic
902996640 1:20230516-20230538 CCCACAGCAGGCCCAGCCAGTGG + Intergenic
903068992 1:20717443-20717465 CCGGCAGGCCGCCCTGCAGGCGG - Intronic
903233108 1:21933790-21933812 CCTGCAGCCGGCACAGGATGGGG - Intronic
903969404 1:27109121-27109143 CCCTCAGCAGCCCCAGTAGGAGG - Intronic
904619623 1:31767382-31767404 GCAGCGGCCAGCCCAGCAGGAGG - Intergenic
905308621 1:37034879-37034901 CCAGCGGCCGGACCAGCTGGAGG + Intergenic
906231914 1:44171583-44171605 CCCACAGCAGGCCTAGCTGGTGG + Intergenic
906399013 1:45491171-45491193 CGCCTACCCGGCCCAGCAGGGGG + Intergenic
906492841 1:46281344-46281366 CCCGCAGGCTGTCTAGCAGGCGG + Exonic
906640788 1:47439255-47439277 CCCGCAGCCGGCACCGCGGCGGG + Exonic
907319578 1:53594192-53594214 CACGCAGCCAGCCCAGAAGCAGG + Exonic
907569829 1:55472910-55472932 GCTCCAGGCGGCCCAGCAGGAGG + Intergenic
908492868 1:64663873-64663895 CCCTCCACAGGCCCAGCAGGGGG + Intronic
910597094 1:88992444-88992466 CCTGCAGCCACCCCCGCAGGCGG + Intronic
911358056 1:96845673-96845695 CCCACAGCATGCCCAGTAGGTGG - Intergenic
912466380 1:109877630-109877652 CCTACAGCCTGGCCAGCAGGAGG - Intergenic
914587524 1:149076310-149076332 CCCTCAGCCGGCCAAGCATCTGG + Intronic
915108694 1:153549557-153549579 CCAGCAGGGGGCCCAGCAGTGGG - Intronic
915358282 1:155269542-155269564 ACCGCAGCCAGCGCAGCAGCCGG - Exonic
915512715 1:156395177-156395199 GGCCCAGCTGGCCCAGCAGGAGG + Intergenic
916747727 1:167697443-167697465 CCAGCACCCGGCCCAAGAGGAGG + Exonic
916761673 1:167823086-167823108 CCCACAGCCGCCCCAGCACCTGG + Exonic
919465695 1:197920000-197920022 CCCGCAGCCGGCGCACAGGGCGG - Exonic
919762954 1:201110007-201110029 CACTCAGCCAGCCCTGCAGGTGG + Intronic
920284338 1:204868786-204868808 CCCCCAGGCCACCCAGCAGGGGG + Intronic
922674534 1:227542458-227542480 CCCGGCTCCGGCCCAGGAGGAGG - Intergenic
922853625 1:228755535-228755557 ACCGCAGCCAGCCCAGCCAGAGG - Intergenic
1063436077 10:6032576-6032598 GCCTCAGCCTCCCCAGCAGGTGG - Intronic
1064873107 10:19962503-19962525 GCCTCAGCCTCCCCAGCAGGTGG + Intronic
1067091323 10:43266975-43266997 CCCGCAGCTGGCGCAGCGCGGGG - Intergenic
1068335455 10:55628324-55628346 CCCGCAGCCTCTCCAGCGGGAGG - Intergenic
1068632443 10:59311714-59311736 CCCGCAGCCGGAAGAGAAGGTGG + Intronic
1070767902 10:79067177-79067199 CCCGGAGGCGGCCCAGGCGGGGG - Intergenic
1070865499 10:79706122-79706144 CCCGCTCCCGGCCCAGCACACGG + Exonic
1070879293 10:79844253-79844275 CCCGCTCCCGGCCCAGCACACGG + Exonic
1071632399 10:87228343-87228365 CCCGCTCCCGGCCCAGCACACGG + Exonic
1071645852 10:87360561-87360583 CCCGCTCCCGGCCCAGCACACGG + Exonic
1073102675 10:101014993-101015015 CCCACAGCCTCCCCAACAGGTGG + Intronic
1073114434 10:101083331-101083353 CCCACAGCCTGCCCAGCATCCGG + Intergenic
1074412306 10:113239029-113239051 CCCTCAGCCTTCCCAGTAGGTGG + Intergenic
1075037338 10:119080481-119080503 CCCGCCGCTGTCCCAGCCGGTGG - Intronic
1075207012 10:120456982-120457004 CCCGGCGCGGGCCCAGGAGGCGG + Exonic
1075550527 10:123389456-123389478 CCAGCAGCCACCCCAGCTGGAGG - Intergenic
1075556350 10:123435325-123435347 GCAGCAGCTGCCCCAGCAGGAGG + Intergenic
1075754758 10:124801914-124801936 CCCCCAGCGGGCGCGGCAGGGGG - Intronic
1076175815 10:128367005-128367027 CCCGCAGACTGCCCAGCCGTGGG - Intergenic
1076474866 10:130744797-130744819 CCCCCATCTGGCCCAGCAGGTGG - Intergenic
1076761164 10:132606371-132606393 CACGCAACCGCCCCAGCAGGAGG - Intronic
1076991788 11:279516-279538 CCCGGAGCCTGCCCTGGAGGTGG + Exonic
1077028070 11:450537-450559 CCGGCAGACGGCCCGTCAGGCGG - Exonic
1077060920 11:617583-617605 CCCGCAGCGGCCCGAGCTGGCGG - Exonic
1077123980 11:924514-924536 CACGGAGCCGACCCAGCAGAGGG - Intergenic
1078185704 11:9050532-9050554 CCTGCAGCCAGCCGAGCTGGAGG - Intronic
1079399023 11:20090976-20090998 CCCGGAGCTGGTCCAGCTGGTGG - Exonic
1080902629 11:36510259-36510281 CCCGCAGCCAGCAGAGAAGGCGG - Exonic
1081808476 11:45902518-45902540 CCCCCAGGCGGGGCAGCAGGGGG - Exonic
1083678550 11:64340985-64341007 CCCTCAGTCGGCCCCACAGGTGG - Exonic
1083920307 11:65778758-65778780 CCCGCAGCAGGCCCTGCTGTAGG + Exonic
1084154635 11:67306831-67306853 CCCCCAGGCAGCCCAGCTGGAGG + Exonic
1084361390 11:68670396-68670418 CCCGGGGCCTGCCCAGCAAGAGG - Intergenic
1084459244 11:69286992-69287014 CTCTCAGCAGGCTCAGCAGGCGG - Intergenic
1084601307 11:70147421-70147443 GCCACAGGGGGCCCAGCAGGAGG - Intronic
1084680298 11:70662869-70662891 CCCGCAGGCCACCCAGAAGGTGG - Intronic
1084979593 11:72822089-72822111 GGCGCAGCAGGCCCAGCAGGTGG + Exonic
1085266720 11:75241778-75241800 TGCGCAGCCAGGCCAGCAGGGGG - Exonic
1085396434 11:76209246-76209268 CCTGCAGCGGGCCCGGGAGGCGG + Intronic
1085514629 11:77105159-77105181 CCTGCAGCGGGCACAGCAGAGGG - Intronic
1086887960 11:92225512-92225534 CTCCCAGCCGCCCCTGCAGGTGG + Intergenic
1087673185 11:101129203-101129225 CCCGCCCCCGACCCAGGAGGTGG - Exonic
1089073881 11:115721618-115721640 CCCCCAGCAGCCCCACCAGGGGG - Intergenic
1091596354 12:1881530-1881552 CCAGTAGCCAGCCCAGCAGGAGG - Intronic
1091938157 12:4449996-4450018 CCCCCGGGCTGCCCAGCAGGAGG - Intergenic
1096104167 12:48986849-48986871 CCCCCAGCCGGGCCAGGCGGCGG - Intergenic
1096771590 12:53939131-53939153 CCGGCGGGCGGCCCAGCACGGGG - Exonic
1097047195 12:56196012-56196034 GCCTCAGCCTCCCCAGCAGGTGG + Intergenic
1097241182 12:57576313-57576335 CCCGGAGCCGGGCCAGCTGCCGG - Exonic
1103363774 12:120368645-120368667 AGCGCACCCGGCCCAGCGGGTGG - Intronic
1103407597 12:120686968-120686990 CCAGGCGCCGGCCCAGCAGTCGG - Exonic
1103413013 12:120725968-120725990 CCCGCGTCTGGCCCAGCGGGCGG + Intronic
1103509842 12:121466956-121466978 CCCGCAGCCGGCCCGGGCAGGGG - Intronic
1103556337 12:121768854-121768876 ACTGCACCCGGCCCAGCTGGGGG - Intronic
1103851602 12:123937135-123937157 CCCGCCGCAGGCCCAGCCCGAGG - Exonic
1104019238 12:124980659-124980681 GCCTCAGCCGGCTCAGCAGCTGG + Exonic
1104376295 12:128267459-128267481 CCAGCAGCGCGCCCAGCAGCAGG - Exonic
1104976516 12:132554326-132554348 CCCTCAGGAGGCCCAGCTGGGGG + Intronic
1105291828 13:19058343-19058365 GTAGCAGCAGGCCCAGCAGGAGG - Intergenic
1105509252 13:21037751-21037773 CCCGCAGCAGGGCCAGCACTGGG + Intronic
1106036909 13:26051723-26051745 CCGGGAGCCTGCCCAGCTGGCGG + Intergenic
1113615537 13:111677912-111677934 GACGCAGCCGGCCCAGGAGGGGG + Intergenic
1113621005 13:111762814-111762836 GACGCAGCCGGCCCAGGAGGGGG + Intergenic
1114671823 14:24415568-24415590 CCCCCAGCAGGCCCTGGAGGAGG - Exonic
1115567466 14:34637136-34637158 ACCGCGCCCGGCCCAGCATGAGG + Intergenic
1117803154 14:59465132-59465154 TCCGCGGCCGGCCCACCTGGCGG - Exonic
1119003850 14:70907372-70907394 ACCGTAGCCGGCCCAGGGGGCGG + Intergenic
1119442437 14:74637350-74637372 GCTGCAGACGGGCCAGCAGGGGG - Intergenic
1119444679 14:74653362-74653384 CCCTCAGCAGGCCCATTAGGAGG - Intergenic
1119660998 14:76451735-76451757 GCCTCAGCCTGCCCAGCAGCTGG + Intronic
1121655606 14:95593442-95593464 CCAGCAGCCAGCCCAGCACAGGG - Intergenic
1122598781 14:102910554-102910576 CAGGGAGCCGGGCCAGCAGGCGG + Exonic
1122636375 14:103131684-103131706 CACCCAGGGGGCCCAGCAGGAGG - Exonic
1122798958 14:104220451-104220473 CCCGCAGGAGGCCCAGCCTGCGG + Intergenic
1123864834 15:24508517-24508539 GCCTCAGCCTCCCCAGCAGGTGG + Intergenic
1124371119 15:29105309-29105331 CCCGCAGCCTCCTCAGCAGGGGG - Intronic
1124690271 15:31815925-31815947 TTCCCAGCCGGCACAGCAGGTGG + Intronic
1126113313 15:45187827-45187849 GCGGGAGCCGGCCCAGGAGGGGG - Intronic
1129697819 15:77750567-77750589 CCAGAAGCAGGCCCAGGAGGTGG - Intronic
1132717765 16:1300747-1300769 CCCTCACCCCACCCAGCAGGAGG - Intergenic
1132937661 16:2489689-2489711 CACGCAGCCGGTCCTGCAGAGGG - Intronic
1133267369 16:4593248-4593270 GCCGCAGCCGGGACAGCAGGTGG - Exonic
1133532141 16:6665262-6665284 CCCTCAGCCACCCCAGCAGTGGG + Intronic
1134089468 16:11383922-11383944 CTCGAAGAAGGCCCAGCAGGCGG + Exonic
1134097142 16:11425269-11425291 CCTGCAGCCGGCCCTTCAGCTGG + Exonic
1134125765 16:11615009-11615031 CCAGCACCCAGCCCAGCAGCTGG + Intronic
1134448690 16:14349829-14349851 GCCTCAGCCACCCCAGCAGGTGG + Intergenic
1134677007 16:16097874-16097896 CCAGCACCTGGCACAGCAGGTGG - Intronic
1136120119 16:28127431-28127453 CCAGCAGCCAGCACAGCAGCTGG + Intronic
1136580465 16:31148414-31148436 CCAGCCGGTGGCCCAGCAGGCGG + Exonic
1137026913 16:35486138-35486160 CCAGCACCCGGACCTGCAGGTGG - Intergenic
1137581829 16:49638272-49638294 CCCGCAGCTGTCCGAGAAGGCGG - Exonic
1138037765 16:53625451-53625473 CCGGCAGCCGCCCCATCTGGGGG + Intronic
1138552533 16:57755356-57755378 CCCCCAGCAGGCCGAGCTGGTGG + Exonic
1138575892 16:57907157-57907179 CCCGCAGAGGGCCCTGCAGAAGG + Intronic
1140935276 16:79664387-79664409 CAGGCAGCCAGACCAGCAGGTGG + Intergenic
1141440798 16:84028612-84028634 CCCGCAGCCCTCCTAGCAGGTGG - Intronic
1141443279 16:84042853-84042875 CCCGGGGCCGGGCCTGCAGGGGG - Intergenic
1141507122 16:84485207-84485229 CCCAGGGCCGGCCCTGCAGGTGG - Intronic
1142161113 16:88558356-88558378 GCCGCAGCCTCCCCAGCAGATGG + Intergenic
1142215265 16:88826706-88826728 CCATCAGCCGGCCCTGCAGGAGG + Exonic
1142292569 16:89199744-89199766 CCAGCAGCCAGCCCAGGAGGTGG + Exonic
1142489734 17:270405-270427 TCCGCAGCCAGCCCAGCCGCTGG - Intronic
1142511266 17:394974-394996 TCAGCAGCCGGGCCAGCTGGAGG + Intergenic
1143136761 17:4716548-4716570 TCAGCAGCCGGTCCTGCAGGCGG - Exonic
1143390232 17:6555860-6555882 CCAGCAGCCGGCGCGGCACGGGG + Intronic
1143635557 17:8162325-8162347 TCCCCAGCCGGGGCAGCAGGGGG + Exonic
1143719330 17:8799042-8799064 CCCGCACCCCGCACACCAGGTGG + Exonic
1144575734 17:16428245-16428267 CACTCAGCCAGGCCAGCAGGGGG + Intronic
1144755997 17:17681240-17681262 CCCGCAGGCCGGCCAGCGGGCGG + Intergenic
1144807525 17:17977691-17977713 CGGGCAGCTGGCCAAGCAGGAGG + Exonic
1146646799 17:34581501-34581523 CCTGCAGCCGGCCGGGCTGGGGG + Intronic
1146957667 17:36946244-36946266 CCCGCAGGAGGCGCAGCAGGAGG + Intergenic
1147145468 17:38482161-38482183 GCCAGAGCAGGCCCAGCAGGGGG + Intronic
1147256215 17:39183981-39184003 CCCACATCCGGCCCAGAAAGGGG + Intronic
1148029793 17:44611690-44611712 CCTCCAGCCGTCCCAGCAGAGGG - Intergenic
1148393065 17:47287325-47287347 CCTGCACCCTGCCCAGAAGGAGG - Intronic
1148503519 17:48109545-48109567 ACCGCACCCGGCCCATCTGGAGG + Intronic
1148849459 17:50547749-50547771 CCCACAGGAGTCCCAGCAGGTGG + Exonic
1150228148 17:63534855-63534877 ACCCCAGCCTGTCCAGCAGGGGG + Intronic
1151625043 17:75271140-75271162 CGCGCCACCGGCCCGGCAGGTGG - Exonic
1151829398 17:76540717-76540739 CATCCAGCCTGCCCAGCAGGCGG - Intronic
1151836605 17:76586217-76586239 AGCGCAGCCAGCGCAGCAGGTGG - Intronic
1152155345 17:78629281-78629303 CCAGCAGCTGGCCCGGCGGGAGG - Intergenic
1152356810 17:79811525-79811547 GGCGCAGGCTGCCCAGCAGGGGG - Intergenic
1152526003 17:80888742-80888764 GCCCCAGCCGGCCCGGCACGTGG - Intronic
1152589469 17:81204295-81204317 TCCCCAGCTGGCCCTGCAGGTGG + Intronic
1152689724 17:81712473-81712495 GCAGCAGGCGGCCCCGCAGGAGG - Exonic
1152809586 17:82375296-82375318 CCCGCACGCGGCCGCGCAGGTGG - Exonic
1152841291 17:82570376-82570398 ACCTCAGCCGCCCCAGCAGCTGG - Intronic
1152947300 17:83205132-83205154 GCCGCAGCCAGCACAGCAGGTGG - Intergenic
1152947464 17:83205778-83205800 CCAGCAGGCGGCGCTGCAGGAGG - Intergenic
1152947498 17:83205914-83205936 CCAGCAGGCGGCGCTGCAGGAGG - Intergenic
1152961907 18:84895-84917 CCCACAGCGGGCCCAGCACAGGG - Intergenic
1153238691 18:3012636-3012658 CCCGCCCCCGGCCCTGCGGGAGG - Intronic
1154198535 18:12283338-12283360 CCCGCAGACAGCCCTGCGGGTGG + Intergenic
1154332680 18:13442600-13442622 CCCGCAGCCGGCCGGCCAGCAGG - Intronic
1155209355 18:23587051-23587073 TGCGCAGCTGGGCCAGCAGGTGG - Intergenic
1156337973 18:36186937-36186959 CCCGGAGCGGGCCCTGCAGCTGG - Intergenic
1157454180 18:47811353-47811375 CCCTCAGCCTCCCCAGCAGCTGG - Exonic
1157541618 18:48514923-48514945 CCTGCAGCTGGCCCAGCGTGGGG + Intergenic
1158495889 18:57954876-57954898 GCCTCAGCCGACCCCGCAGGGGG + Intergenic
1159255770 18:65943409-65943431 CCTGCAGCATGCCCAGCAGATGG - Intergenic
1160562832 18:79770460-79770482 CCCGGAGCCGGCCCAGCACGGGG + Intergenic
1160563298 18:79772147-79772169 CCCGCACCAGGCCCCGAAGGCGG + Intergenic
1160583267 18:79899687-79899709 CCCCGAGCCGGCCCTGCAGGAGG + Exonic
1160919806 19:1514022-1514044 CCCTCAGCCCGCCCGCCAGGGGG - Intergenic
1161065681 19:2236191-2236213 CCGGCAGCCGGCCGAGATGGCGG - Exonic
1161346660 19:3771748-3771770 CCCGCTGCCGTCCCACCAGGTGG - Exonic
1161466926 19:4436268-4436290 CCCTCAGCTGTCACAGCAGGAGG + Intronic
1161699483 19:5787084-5787106 CCCGCAGCTCGGGCAGCAGGCGG + Exonic
1162418787 19:10553983-10554005 TCCGCTGCCGGCCCAGCTGGCGG + Exonic
1163153725 19:15429077-15429099 CCCACAGGCAGCCCAGGAGGTGG + Intronic
1163563903 19:18038314-18038336 GCCTCAGCCGCCCCAGCAGCTGG + Intergenic
1163845364 19:19635474-19635496 CCCGCAGTCGCCGCAGCTGGTGG + Exonic
1164692633 19:30222596-30222618 CCCGCAGACGGCCGGGCAGGGGG - Intergenic
1165063763 19:33217672-33217694 CCCCCTGCGGGCCCGGCAGGTGG - Intronic
1165236915 19:34428766-34428788 TCCGGAGCCGGCCCAGCGAGCGG - Intronic
1165420056 19:35718072-35718094 CCCGCGGCCGGCCCGGGAAGCGG - Exonic
1165445742 19:35856134-35856156 TGCGCAGCTGGCCGAGCAGGTGG - Intronic
1166311819 19:41967328-41967350 CCCTCTGCAGGCCCAGCTGGTGG - Exonic
1166560471 19:43729429-43729451 CCCTGAGCTGGGCCAGCAGGAGG + Exonic
1166834134 19:45656848-45656870 GCCTCAGCCTCCCCAGCAGGTGG + Intergenic
1166844257 19:45717264-45717286 CCCGCAGCCCCCCCAGGCGGCGG + Intronic
1166986163 19:46661013-46661035 CCCGCAGCCGGCCCCGCTCAGGG + Exonic
1167003197 19:46757781-46757803 CCCGCGCCCGGCCCAGCACCCGG - Exonic
1167649720 19:50722732-50722754 CCCACAGCCTGGCCTGCAGGAGG + Intergenic
1168293433 19:55368215-55368237 GCTGCAGCCGGCGCAGCAGCCGG + Exonic
1168726574 19:58586148-58586170 CCCACAGCGGGCCCAGCACAGGG + Intergenic
924987789 2:287793-287815 CCAGCAGCAGCCCCAGGAGGAGG + Exonic
925315421 2:2919273-2919295 GCCTCAGCCAGCCCAGCAGCGGG - Intergenic
933246858 2:79985714-79985736 CAAGCAGCAGGCCCAGCAGCAGG + Intronic
934524088 2:95040695-95040717 CCCGCAGTCCTCCCAGCAGACGG + Intronic
937129855 2:119501460-119501482 CCCCCACCCTTCCCAGCAGGTGG - Intronic
938343803 2:130552374-130552396 CCCGCTGCCATCTCAGCAGGAGG - Intergenic
938346030 2:130568348-130568370 CCCGCTGCCATCTCAGCAGGAGG + Intergenic
938408253 2:131044594-131044616 CCGGCAGGCGGCCAGGCAGGCGG - Intronic
942578644 2:177392918-177392940 CCCGGGGCCGGCCCAGCAGATGG - Exonic
943955165 2:194178747-194178769 GCCTCAGCCTGCCCAGCAGCTGG - Intergenic
947633118 2:231666365-231666387 CCCTGAGGCGGCGCAGCAGGAGG + Intergenic
947749060 2:232523486-232523508 CCCGCAGCCGTCCCCCCAGGAGG - Exonic
948437891 2:237966549-237966571 CCCGCAGCCTGCAGTGCAGGCGG - Intergenic
948898906 2:240946182-240946204 CCAGCTGCTGGCCAAGCAGGAGG + Intronic
949044473 2:241866221-241866243 CCAGCAGGGGGACCAGCAGGGGG - Intergenic
1169557810 20:6768414-6768436 CCCGGAGCCGGCCCCGCGCGGGG + Exonic
1172273465 20:33667362-33667384 CCCGCAGGCCGCCCACCAGCAGG - Exonic
1173734053 20:45347406-45347428 CCCGCAGCCGGCTTAGGAGGAGG - Intronic
1173948648 20:46972618-46972640 CCCACAGCAGCCCCAGGAGGTGG + Intronic
1174281824 20:49445293-49445315 ACAGCAGCCAGCCCAGCAGCTGG + Intronic
1174379382 20:50146874-50146896 CCAGCAGCCGCCCCAGCCTGGGG + Intronic
1175273729 20:57753450-57753472 TCCGCACCAGGCCCTGCAGGAGG - Intergenic
1175891001 20:62315902-62315924 CTCGCAGCCGGCCGACCATGAGG - Intronic
1176146279 20:63566880-63566902 CTCGCGGCCGCCCCAGCAGCTGG + Exonic
1176263797 20:64197994-64198016 ACCGCGCCCGGCCCAGCAGAAGG - Intronic
1178830645 21:36053880-36053902 CCTGCAGGAGGCCCAGCAGTAGG - Intronic
1178913627 21:36695087-36695109 CCCACAAGCGGCCCAGGAGGTGG + Intergenic
1178926663 21:36780943-36780965 CCCCCAGGCTGCACAGCAGGAGG + Intronic
1180615064 22:17121220-17121242 CCCGCCGCCTCCCCAGCAGTGGG + Exonic
1181077718 22:20392777-20392799 GCCGCAGCCAGCCCAGGAAGGGG + Intergenic
1181610063 22:24006253-24006275 CCCCCAGCTGGCCCAGAAGCAGG - Intergenic
1182532182 22:30969123-30969145 CACGCAGCCCGCCAATCAGGAGG - Intergenic
1183255714 22:36760577-36760599 CCCACAGCAGGCTCCGCAGGAGG + Intronic
1183522629 22:38304148-38304170 CCAGCAGCGAGCCCAGCAGGAGG + Intronic
1183601595 22:38843528-38843550 CCCGTCGGGGGCCCAGCAGGGGG - Exonic
1183612288 22:38917313-38917335 ACCGCACCCGGCCCAGCTGCTGG + Intergenic
1184075536 22:42174918-42174940 GCCTCAGCCGCCCCAGCAGCTGG - Intronic
1184132682 22:42526865-42526887 ACCGCGCCCGGCCCAGCAGAGGG + Intergenic
1184160354 22:42693912-42693934 CCCGGAGCAGCCGCAGCAGGAGG + Exonic
1184458342 22:44623978-44624000 CCCCCAGATGGCCCAGCAGGTGG - Intergenic
1184571835 22:45329869-45329891 CCCGGAGCCCGCACAGCAGCAGG - Intronic
1185251534 22:49804236-49804258 ACTGCAGCCGCCGCAGCAGGGGG + Exonic
1185313768 22:50170320-50170342 CCCGCCGCCGCCCCCGCCGGAGG + Intergenic
950406840 3:12810215-12810237 CGGGCAGCCGGTCCAGTAGGTGG - Exonic
951711738 3:25590632-25590654 ACCTCAGCCTGCCCAGCAGATGG + Intronic
954149201 3:48648781-48648803 CCAGCAGGTGGGCCAGCAGGCGG + Exonic
954216171 3:49125663-49125685 CCAGCAGCAGGTCCAGAAGGAGG + Intronic
954410225 3:50367362-50367384 CCCGCAGTGTGCCCAGCAGCAGG - Intronic
954411501 3:50373305-50373327 CCCCCAGTCGGCCAGGCAGGTGG + Intronic
954798764 3:53175057-53175079 CCCCCGGCCTGCCCAGCAGGAGG - Intronic
956900405 3:73709503-73709525 CCCTCAGCTTGCCAAGCAGGAGG + Intergenic
958858359 3:99414872-99414894 CCCTCAGCCTCCCCAGCAGCTGG - Intergenic
959712226 3:109396592-109396614 CTCGTGGTCGGCCCAGCAGGCGG - Intergenic
961345184 3:126259619-126259641 CCCACAGCCTGACCAGCGGGGGG + Intergenic
961652956 3:128426453-128426475 CCCGCGGCGGGCCGAGGAGGGGG - Intergenic
961869215 3:129975891-129975913 GCCAGAGGCGGCCCAGCAGGAGG + Exonic
962816510 3:139005736-139005758 TCCGCAGCCGGCTCAGCCGCTGG - Exonic
962820502 3:139044091-139044113 TCCGCAGCCGGCTCAGCCGCTGG - Exonic
963160925 3:142149769-142149791 CCCGCAGCTGTCCCTGGAGGCGG - Intergenic
966824289 3:183950980-183951002 CCCGCAGCAGGCCTGTCAGGCGG - Intronic
966928777 3:184662481-184662503 CCTGCAGCCAGCCCTCCAGGGGG + Intronic
968083963 3:195866313-195866335 GCCTCAGCCTCCCCAGCAGGTGG + Intronic
968159404 3:196413221-196413243 CCCTCAGCCTGCCCAGTAGCTGG - Intronic
969346856 4:6575434-6575456 CCCGATGCCGGCGCAGAAGGAGG + Intronic
969569771 4:8001588-8001610 CACCCTGCCTGCCCAGCAGGAGG + Intronic
971196158 4:24472746-24472768 CACGCAGCCGGCACAGGCGGCGG - Intergenic
971454555 4:26832065-26832087 CCCACAGCTTGCCCAGCATGTGG - Intergenic
972345713 4:38190808-38190830 CCAGCAGCTGGCCCAGCTGTGGG + Intergenic
973894239 4:55396166-55396188 TGCGCGGCCGGCCCGGCAGGCGG + Exonic
976146107 4:82044151-82044173 CCCGCAGCCCGCCCGCCAGCCGG + Intronic
978701768 4:111655373-111655395 GCCTCAGCCGCCCCAGCAGCTGG + Intergenic
979230740 4:118346625-118346647 CCCCCAGGCTGCCCAGCAGGAGG + Intronic
980550546 4:134328597-134328619 GCAGCAGCTGGCCCAGGAGGAGG + Intergenic
984266146 4:177499780-177499802 CCCCCATCAAGCCCAGCAGGCGG - Intergenic
984758219 4:183343008-183343030 TGCGCTGCCGGCCCTGCAGGAGG - Intergenic
985758780 5:1734286-1734308 CCCGCAGCCAGGACAGCAGATGG - Intergenic
985788600 5:1913108-1913130 CCTGCAGCCATCCCTGCAGGGGG + Intergenic
986051547 5:4094778-4094800 CCTGCACCTGGCACAGCAGGTGG + Intergenic
986136454 5:4984029-4984051 CCCCCAGCAGCCCCAGCAGGGGG + Intergenic
987088068 5:14487785-14487807 GCCCCAGCGCGCCCAGCAGGCGG + Exonic
987258299 5:16179593-16179615 CCGCCAGCCGGGCCGGCAGGAGG - Exonic
989625771 5:43428353-43428375 CAGGCAGCAGGCCCTGCAGGAGG - Intergenic
994320793 5:98392430-98392452 CCCGCAGCCGGCCCAGCAGGAGG - Intergenic
995841438 5:116446810-116446832 CCCGCCGCCCGCCCCGCAGAGGG - Exonic
998328612 5:141304083-141304105 CCAGCTGCCGGCCCAGCGCGCGG + Intergenic
998499548 5:142620301-142620323 CCCTCAGCCTCCCCAGCAGCTGG - Intronic
998765560 5:145482999-145483021 CCCGCAGGCCACACAGCAGGAGG - Intronic
999242616 5:150136531-150136553 CCAGCAGCCTGCCCGGCAGCTGG - Intronic
1002140347 5:177133919-177133941 CCCCCAGCTGGCCCGGGAGGGGG + Exonic
1002565608 5:180111553-180111575 CCTGGAGCTGGCCAAGCAGGTGG - Exonic
1002581651 5:180212523-180212545 CCAGCAGCACCCCCAGCAGGAGG + Intergenic
1002741181 5:181436818-181436840 GCCGCAGCCAGCACAGCAGCAGG - Intergenic
1003645559 6:7910728-7910750 CCCGCTGCTGGCCCGGCCGGCGG - Exonic
1006081925 6:31572799-31572821 CCAGCAGCAGCCCCAGAAGGAGG - Exonic
1006148131 6:31971342-31971364 CCAGGAGCCAGCACAGCAGGTGG + Exonic
1007132326 6:39487290-39487312 CCAGCAGCAGTCCCAGCAGCTGG - Intronic
1007284244 6:40736373-40736395 CCCAGGGCAGGCCCAGCAGGTGG + Intergenic
1008629350 6:53348636-53348658 CCCGGAGCCGGCGGAGCTGGAGG + Intronic
1010141998 6:72622601-72622623 CCTGCAGCGGGCATAGCAGGGGG - Intronic
1010202966 6:73299174-73299196 CACGCAGCTGGACCAGCACGGGG + Intronic
1013225779 6:108118588-108118610 CCCGCTCCGGGCCCCGCAGGCGG - Intronic
1015525967 6:134175515-134175537 GCCGCCGCCGGCCCCGCTGGGGG - Intronic
1018199369 6:161380968-161380990 CCCCCACCCGCCCCAGCATGGGG + Intronic
1018613022 6:165662090-165662112 CCCGGCGCCGGCCCAGGCGGCGG - Intronic
1019246296 6:170712515-170712537 GCCGCAGCCAGCACAGCAGCAGG - Intergenic
1019246412 6:170712957-170712979 CCAGCAGGCGGCGCTGCAGGAGG - Intergenic
1019616608 7:1965787-1965809 CCCACGCCCGGCCCTGCAGGAGG - Intronic
1019909977 7:4094349-4094371 ACCGCGCCCGGCCCAGCCGGGGG + Intronic
1022336066 7:29423301-29423323 CCTGCAGCCTGCCCAGCTGCTGG - Intronic
1022443535 7:30452279-30452301 CCTCCAGCTGGCTCAGCAGGCGG + Exonic
1023986974 7:45102437-45102459 CCTGGAGCCAGCCCTGCAGGTGG - Exonic
1024774477 7:52766456-52766478 GCCTCAGCCGCCCCAGCAGCTGG - Intergenic
1025875530 7:65477194-65477216 CCTCCAGCAGGCCCAGCAGTCGG + Intergenic
1026615497 7:71899256-71899278 GCCGCAGCCTCCCCAGCAGCTGG + Intronic
1026822150 7:73557172-73557194 CCCGCGCCCGGCCCAGCCCGGGG - Intronic
1026848664 7:73711649-73711671 CTGGCAGCCTGCCCAGGAGGAGG - Intronic
1026925104 7:74186326-74186348 GCCTCAGCCTGCCCAGCAGCTGG + Intronic
1029232050 7:99078530-99078552 CCCCCAGGCTGCACAGCAGGAGG + Intronic
1029578756 7:101420964-101420986 CCCACAGCCTGCCCAGCCTGGGG + Intronic
1029610700 7:101625148-101625170 CACGCAGCAGGCAAAGCAGGAGG + Intronic
1030813841 7:114009293-114009315 CCCGCTCCCAACCCAGCAGGTGG - Intronic
1031076809 7:117221039-117221061 CCCCCAGCACCCCCAGCAGGTGG + Intronic
1031213398 7:118859067-118859089 GCCTCAGCCAGCCCAGAAGGGGG + Intergenic
1032089598 7:128904593-128904615 CCGGCAGTCTGCCCAGCAGCAGG + Intronic
1032255545 7:130294466-130294488 CCCACAGGCGGCTCAGCAGTAGG + Intronic
1034536819 7:151730601-151730623 CCAGCAGCCAGGCCAGCAGATGG + Intronic
1035501776 8:95174-95196 GCCGCAGCCAGCACAGCAGCAGG + Intergenic
1036224069 8:6943532-6943554 CATGCAGCTGGCTCAGCAGGTGG - Intergenic
1036773063 8:11592184-11592206 CCCCCACCCGGCCCAGGAGCTGG - Intergenic
1037993803 8:23338861-23338883 GCTGCAGCAGGGCCAGCAGGTGG + Intronic
1038883653 8:31640248-31640270 CCCGCAGCGGCGGCAGCAGGGGG + Intronic
1042250886 8:66755142-66755164 GCCTCAGCCTGCCCAGCAGCTGG - Intronic
1044248994 8:89984524-89984546 CCCGCCGCGGGCCCGGCAGGAGG - Exonic
1049225303 8:141447926-141447948 CAAGCAGCAGGCCCAGGAGGCGG - Intergenic
1049836360 8:144738128-144738150 CCCTCACCCGGCCCAGCAGGCGG + Intronic
1060297735 9:122354783-122354805 GCAGCAGCAGGGCCAGCAGGAGG + Intergenic
1060970629 9:127735416-127735438 TCCGCAGCAGGACCAGAAGGTGG + Intergenic
1061626365 9:131842827-131842849 CCCGCAGCCAGCCTGTCAGGAGG - Intergenic
1061725589 9:132580480-132580502 CCCGCCGCCGGCCGGGCTGGGGG - Intergenic
1061940966 9:133883593-133883615 CAGGCAGGCGGCCCAGCAGCAGG + Intronic
1061961196 9:133990241-133990263 CCCTCTACCGGCCCAGCAGCGGG + Intronic
1062110137 9:134777724-134777746 CCCCCAGCCTGCCCAGCCAGAGG + Intronic
1062272173 9:135714570-135714592 CCCGCAGGCGGCCCTGCGCGGGG + Exonic
1062305942 9:135907256-135907278 CCCGCAGCCGGCCAGCCGGGAGG + Intergenic
1062589307 9:137266345-137266367 CCAGCAGCCGGAGCAGCAGCAGG - Exonic
1203607060 Un_KI270748v1:67898-67920 GCCGCAGCCAGCACAGCAGCAGG - Intergenic
1187868956 X:23748672-23748694 GCCTCAGCCGCCCGAGCAGGTGG - Intronic
1190081137 X:47357623-47357645 GCCTCAGCCTCCCCAGCAGGTGG - Intergenic
1190302019 X:49062529-49062551 CCGGCAGCGGACCCTGCAGGAGG + Exonic
1199500400 X:148500755-148500777 CCCGCAGCCAGCCAGGCGGGCGG + Exonic
1199584367 X:149398128-149398150 CCAGCAGCAGGCACTGCAGGTGG - Intergenic
1200142891 X:153910552-153910574 CGGGCAGCCGCCACAGCAGGCGG + Exonic
1200398474 X:156005271-156005293 CCCACAGCAGGCCCAGCACAGGG + Exonic
1201905790 Y:19084588-19084610 CCCTCAGCCTCCCCAGCAGCTGG + Intergenic
1201987730 Y:19987791-19987813 CCAGCAGCCAGCAAAGCAGGTGG - Intergenic