ID: 994320796

View in Genome Browser
Species Human (GRCh38)
Location 5:98392433-98392455
Sequence TGCCCCGCAGCCGGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 520}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994320796_994320803 17 Left 994320796 5:98392433-98392455 CCTGCTGGGCCGGCTGCGGGGCA 0: 1
1: 0
2: 3
3: 37
4: 520
Right 994320803 5:98392473-98392495 CTTGCGGTTGGCATCCTTAACGG 0: 1
1: 0
2: 9
3: 18
4: 55
994320796_994320798 -10 Left 994320796 5:98392433-98392455 CCTGCTGGGCCGGCTGCGGGGCA 0: 1
1: 0
2: 3
3: 37
4: 520
Right 994320798 5:98392446-98392468 CTGCGGGGCAGCCTCCAGCTCGG 0: 1
1: 3
2: 13
3: 49
4: 333
994320796_994320800 1 Left 994320796 5:98392433-98392455 CCTGCTGGGCCGGCTGCGGGGCA 0: 1
1: 0
2: 3
3: 37
4: 520
Right 994320800 5:98392457-98392479 CCTCCAGCTCGGACAGCTTGCGG 0: 1
1: 1
2: 1
3: 16
4: 124
994320796_994320802 5 Left 994320796 5:98392433-98392455 CCTGCTGGGCCGGCTGCGGGGCA 0: 1
1: 0
2: 3
3: 37
4: 520
Right 994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG 0: 1
1: 0
2: 11
3: 24
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994320796 Original CRISPR TGCCCCGCAGCCGGCCCAGC AGG (reversed) Intergenic
900369128 1:2323702-2323724 AGCCCTGCAGCCGGCCTTGCTGG + Intronic
901129716 1:6954737-6954759 TGCCCCGCCGCCTGGGCAGCTGG + Intronic
901489381 1:9588961-9588983 TGCCCCACGGCCGGCCTGGCCGG + Exonic
901506694 1:9689761-9689783 TGCCCCGCCCCCAGCCCCGCCGG + Intronic
902027519 1:13394964-13394986 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
902449313 1:16486517-16486539 GGCCCTGCTGCAGGCCCAGCTGG - Intergenic
902505435 1:16936760-16936782 GGCCCTGCTGCAGGCCCAGCTGG + Exonic
902554836 1:17240782-17240804 AGCCCCGCAGACCCCCCAGCAGG - Intronic
902719305 1:18293422-18293444 TGCTCCCCAGGCGGCCCGGCTGG + Intronic
902747309 1:18482430-18482452 GGCCCCGGAGCCGGCGCTGCAGG - Exonic
903115690 1:21176737-21176759 TCCCCCGCCGCCGGCCCATGAGG - Exonic
903508173 1:23853313-23853335 TGCCCGGCAGCCACCCCATCCGG + Intronic
903641651 1:24864101-24864123 GCCACCGCACCCGGCCCAGCTGG + Intergenic
903748439 1:25603977-25603999 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
904814773 1:33187585-33187607 TGCCCCTCACCTGGTCCAGCAGG + Intergenic
904831653 1:33309541-33309563 CGCCCGGCAGCCGCCCCACCTGG - Intronic
905308618 1:37034876-37034898 AGCCCAGCGGCCGGACCAGCTGG + Intergenic
905599161 1:39234704-39234726 CGCCCGGCAGCCGCCCCATCTGG - Intronic
905699354 1:39999920-39999942 CGCCCGGCAGCCGCCCCATCCGG + Intergenic
906223694 1:44103681-44103703 CGCCCTCCAGCCGGCCAAGCAGG - Intergenic
906231912 1:44171580-44171602 TGGCCCACAGCAGGCCTAGCTGG + Intergenic
906286067 1:44588686-44588708 GGCCCAGCAGTCGGCCCAGCTGG - Intronic
906308805 1:44738646-44738668 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
906308887 1:44738853-44738875 TGCCCCGCCGCCACCCCATCTGG + Intergenic
906486783 1:46240978-46241000 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
910379273 1:86608855-86608877 TGCCCCGTAGCCACCACAGCTGG + Intergenic
910815718 1:91289060-91289082 CGCCCGGCAGCCGCCCCATCCGG - Intronic
911325847 1:96469791-96469813 TGCCCGGCAGCCCCCCCATCCGG - Intergenic
911533998 1:99078691-99078713 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
912316974 1:108675827-108675849 TGCCCGGCAGCCACCCCATCTGG + Intergenic
912355785 1:109053445-109053467 CGCCCAGCAGCCGCCCCATCTGG + Intergenic
912371468 1:109177255-109177277 TGCCCGGCAGCCGCCCCGTCCGG - Intronic
913293938 1:117300778-117300800 TGCCCAGCCGCCGCCCCATCTGG - Intergenic
914787973 1:150851082-150851104 CGCCCCGCAGCCGCCCCGTCCGG + Intronic
914893844 1:151651440-151651462 TGCCCGGCAGCCGCCCCATCTGG - Intronic
915208408 1:154287757-154287779 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
915549855 1:156625539-156625561 CTCCCCGCCGCCGGGCCAGCCGG - Exonic
915604465 1:156941880-156941902 TCCCCGGGAGCCAGCCCAGCAGG - Exonic
915619820 1:157074326-157074348 CGCCCTGCAGCGGGCCAAGCAGG + Intergenic
916037326 1:160933341-160933363 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
916050049 1:161029718-161029740 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
916131635 1:161616603-161616625 TGCCCGGCAGCCACCCCATCTGG - Intronic
916320499 1:163499004-163499026 TGCCCGGCCGCCGCCCCATCTGG - Intergenic
917553311 1:176058052-176058074 CGCCCGGCAGCCGCCCCGGCCGG + Intronic
918148193 1:181776236-181776258 GGCCCCTCGGCCGCCCCAGCGGG + Intronic
918527425 1:185480113-185480135 TGCCCAGCTGGCAGCCCAGCAGG + Intergenic
918701689 1:187616048-187616070 TGCCCAGCCGCCGCCCCATCTGG + Intergenic
919097940 1:193059573-193059595 TGCCCCGCCTCCGCCCCAGAGGG - Intronic
920065527 1:203266766-203266788 CGCCCGGCAGCCGCCCCATCTGG - Intronic
920333392 1:205228163-205228185 CGCCCCGCAGCCCGGCCGGCCGG + Exonic
921043943 1:211460524-211460546 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
921109100 1:212015059-212015081 CGCCCGGCAGCCGCCCCATCCGG + Intronic
921192836 1:212725114-212725136 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
921944943 1:220879921-220879943 TGCTCCTCGGCCGGCCCAGGCGG + Exonic
922739404 1:228006953-228006975 AGCCCGGCCGCCGGCCCACCTGG + Intergenic
924943736 1:248830411-248830433 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1063776717 10:9273257-9273279 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1065099566 10:22320739-22320761 CGCCCCCCGGCCGGCCCCGCGGG - Intronic
1065204241 10:23342890-23342912 TGCCCCTAAGCCAGCCCACCTGG + Intronic
1065315529 10:24460029-24460051 TTCTCCGCAGTCGGCACAGCAGG - Intronic
1066026132 10:31362150-31362172 TGCCCAGCCGCCGCCCCATCTGG - Intronic
1066390929 10:34976753-34976775 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1067111968 10:43407548-43407570 AGCCGGGCAGCCGGCGCAGCAGG + Intronic
1067295135 10:44971341-44971363 TGGCCCGCAGCAGCCACAGCAGG + Intronic
1068335458 10:55628327-55628349 TTCCCCGCAGCCTCTCCAGCGGG - Intergenic
1069052673 10:63811592-63811614 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1069157780 10:65052225-65052247 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1069674656 10:70238942-70238964 TGCCCGGCAGCCGCCCCATCTGG - Intergenic
1069674973 10:70240086-70240108 TGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1072480935 10:95809547-95809569 TGCCCAGCATCCGCCCCATCTGG - Intronic
1072891799 10:99330509-99330531 AGTCCAGCAGGCGGCCCAGCGGG - Exonic
1073102672 10:101014990-101015012 TGCCCCACAGCCTCCCCAACAGG + Intronic
1073138065 10:101230388-101230410 CGCCCCGCATCCGGAACAGCTGG - Intergenic
1075013810 10:118895728-118895750 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1075108532 10:119559640-119559662 TGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1075892955 10:125970261-125970283 CGCCCAGCAGCCGCCCCATCTGG - Intronic
1076094604 10:127720929-127720951 TGCCCCATAGCCGCCACAGCTGG - Intergenic
1076662047 10:132062221-132062243 TGCCCCTCAGACTGCCCATCAGG + Intergenic
1076668732 10:132107430-132107452 TGCCCCGCAGGGTGCCCAGCGGG - Intronic
1076996177 11:298557-298579 TGCCCTGCACCTGGCCCGGCTGG - Exonic
1077262449 11:1629989-1630011 TCCCCCACAGCCCGCACAGCCGG - Exonic
1077365030 11:2158208-2158230 AGCCTCCCAGCCGGCCCACCGGG + Intronic
1078145772 11:8721063-8721085 TGGCCCTCAGCAAGCCCAGCTGG + Intronic
1079018350 11:16888192-16888214 TGCCCAGCAGCCGCCCCATCTGG + Intronic
1081810259 11:45910393-45910415 GGCCCAGGAGCCAGCCCAGCTGG + Intronic
1082657693 11:55872930-55872952 TGCTCCGCAGCAGGCGCTGCAGG + Intergenic
1083042276 11:59699803-59699825 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1083120821 11:60510440-60510462 TGCCCGGCAGCTGCCCCATCTGG + Intergenic
1083648511 11:64186574-64186596 TGGCCCGCAGCCGCCCCCTCGGG - Intronic
1083732687 11:64661244-64661266 TGCCCTGCAGCAGGCTCAGGAGG + Intronic
1083913955 11:65727982-65728004 TGCCCTGTAGCAGGCCAAGCAGG + Intergenic
1084000988 11:66295412-66295434 TGCCCCCCGCCCGGCCCAGCGGG + Exonic
1084839212 11:71831465-71831487 TGCCCGGCAGCCGCCCCATCCGG + Intergenic
1084839225 11:71831505-71831527 CGCCCGGCAGCCGGCCCGTCCGG + Intergenic
1084924804 11:72502700-72502722 TGCCCGGCAGCCACCCCATCTGG - Intergenic
1084989530 11:72909829-72909851 TGCCCGGCAGCCGCCCCATCTGG + Intronic
1084989541 11:72909869-72909891 TGCCCGGCAGCCGCCCCATCTGG + Intronic
1085443349 11:76582590-76582612 CGCCCGGCAGCCGCCCCATCCGG - Intergenic
1085480876 11:76821607-76821629 TGCCCGGCAGCCACCCCATCTGG + Intergenic
1086122595 11:83316961-83316983 TGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1086434832 11:86770740-86770762 CGCCCCGCAGCCGCCCCGTCTGG - Intergenic
1088170460 11:106990454-106990476 TCCCCAGCAGCTGGCCCTGCAGG + Intronic
1089065610 11:115659787-115659809 TCCCCGGCATCCGGCCCATCGGG - Intergenic
1089148497 11:116347268-116347290 CGCCCAGCAGCCGCCCCATCTGG + Intergenic
1089192845 11:116667039-116667061 TGCCCCGCGCCTGGCTCAGCGGG + Intergenic
1089421120 11:118331921-118331943 CGCCCGGCAGCCACCCCAGCTGG - Intergenic
1090441275 11:126727543-126727565 TACCCTGCACCCTGCCCAGCAGG + Intronic
1091043661 11:132306061-132306083 TGCCCAGCAGTAGGCCCAACCGG - Intronic
1092264036 12:6967759-6967781 AGCCCAGCAGGAGGCCCAGCGGG - Exonic
1092296049 12:7200128-7200150 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1092331466 12:7590303-7590325 TGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1094319704 12:29171560-29171582 TGCCCAGCTGCCGCCCCATCTGG + Intronic
1095939414 12:47716369-47716391 TGCCCAGGAGCTGGCCGAGCAGG - Exonic
1096111762 12:49033175-49033197 TTCCCCCCAGCTGGCACAGCAGG - Exonic
1096116948 12:49060395-49060417 TGCCCCGCCCCCGGCCTGGCCGG + Intergenic
1096260374 12:50086292-50086314 TGCCCCTCAGCAGATCCAGCAGG + Exonic
1096518720 12:52172304-52172326 CGCCCTGCAGCAGGCCAAGCAGG - Exonic
1096532772 12:52252367-52252389 TGCCCTGCAGAAGGCCAAGCAGG - Intronic
1096540843 12:52306152-52306174 TGCCCTGCAGAAGGCCAAGCAGG + Exonic
1096552202 12:52380469-52380491 TGCCCTGCAGCAGGCCAAGCAGG - Exonic
1096562673 12:52447884-52447906 TGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096564843 12:52469776-52469798 TGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096566763 12:52488434-52488456 TGCCCTGCAGAAGGCCAAGCAGG - Exonic
1096611931 12:52807750-52807772 TGCCCTGCAGCAGGCCAAGGAGG - Exonic
1096626427 12:52898785-52898807 CGCCCTGCAGCGGGCCAAGCAGG - Exonic
1096717743 12:53501287-53501309 TGCCCCGCGGCGGGCCCTACCGG + Exonic
1096951626 12:55479275-55479297 TGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1098883753 12:75941880-75941902 TGCCCGGCAGCCACCCCATCCGG + Intergenic
1102001102 12:109558572-109558594 TGCCTCGCGGCCGGCCCATGAGG - Intronic
1102294158 12:111723745-111723767 TGCCCGGCAGCCACCCCATCTGG - Intronic
1102323315 12:111957385-111957407 CGCCCGGCAGCCGCCCCATCTGG + Intronic
1104614537 12:130256936-130256958 GGCCCCGCACCCGGAGCAGCCGG - Intergenic
1104869192 12:131982391-131982413 TCCCTCGCAGCCTGCACAGCTGG + Exonic
1104943201 12:132404403-132404425 TGACCCGCAGCCAACCCAGGTGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106517129 13:30465289-30465311 CGCCCCGCCGCCCGCCCGGCTGG + Intronic
1106799490 13:33242104-33242126 TGCCCCGCCGCCACCCCATCTGG + Intronic
1106799512 13:33242181-33242203 CGCCCAGCAGCCGCCCCATCCGG + Intronic
1107834777 13:44404555-44404577 AGCCCAGCAGCCAGCCCTGCCGG + Intergenic
1110940317 13:81341052-81341074 GGCCCCGCACCCGGAGCAGCCGG - Intergenic
1112077278 13:95928433-95928455 CGCCCAGCAGCCGCCCCATCTGG - Intronic
1112398624 13:99056676-99056698 TGCCGGGCAGCCACCCCAGCAGG - Intronic
1112762134 13:102703321-102703343 TGCCCCGTAGCCAGGCCTGCAGG + Intergenic
1113369337 13:109708216-109708238 TGGCCCGAAGCTGGCCCCGCTGG - Intergenic
1114491974 14:23108333-23108355 TGCCCGGCCGCCGCCCCATCTGG - Intergenic
1116326895 14:43541231-43541253 TGCCCTACAGCGGGCCAAGCAGG - Intergenic
1116351731 14:43871706-43871728 TGCCCCATAGCCGCCACAGCTGG + Intergenic
1116729002 14:48598597-48598619 GGCCCAGCAGCCGCCCCATCTGG + Intergenic
1117411699 14:55456431-55456453 CGCCCGGCAGCCGCCCCATCTGG - Intronic
1118955584 14:70477689-70477711 TGCCCGGCAGCTGCCCCATCTGG + Intergenic
1118955718 14:70477991-70478013 TGCCCGGCTGCCGCCCCATCTGG + Intergenic
1119003849 14:70907369-70907391 CGCACCGTAGCCGGCCCAGGGGG + Intergenic
1119835731 14:77747634-77747656 CGCCCGGCAGCCGTCCCATCTGG + Intronic
1120087110 14:80286830-80286852 CGCCCGGCAGCCGCCCCATCTGG + Intronic
1120406594 14:84099654-84099676 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1122548799 14:102539147-102539169 TGCCCCCCAGCTGTCCAAGCAGG + Intergenic
1122657924 14:103274198-103274220 AGCCCCGCAGCAGCCCCGGCAGG + Intergenic
1122695342 14:103549618-103549640 TGCCCCGCAGCGGCCTCTGCAGG + Intergenic
1122861124 14:104582773-104582795 TCCCCAGCAGCGGGCCTAGCGGG + Intronic
1124237767 15:28004435-28004457 TGCCCCGCTGGCGTCCCCGCAGG - Intronic
1125861561 15:43005175-43005197 CGCCCAGCAGCCGCCCCATCTGG + Intronic
1125861611 15:43005303-43005325 CGCCCGGCAGCCGCCCCATCCGG + Intronic
1126467326 15:48972978-48973000 CGCCCAGCAGCGGGCCAAGCAGG + Intergenic
1126573198 15:50172940-50172962 CGCCCGGCAGCCGCCCCATCCGG + Intronic
1126668231 15:51093985-51094007 TGCCGCGCAGCCGGCGGAGAAGG - Intronic
1126691880 15:51294510-51294532 CGCCCGGCAGCCGCCCCATCTGG + Intronic
1127393180 15:58522985-58523007 TCCCCAGCAGCCGGTCCATCTGG - Intronic
1128153540 15:65377852-65377874 GGCCCCGGCGCCGGCCCCGCGGG - Exonic
1129252509 15:74316587-74316609 TGCCCCTCAGCCTCCCCACCAGG - Intronic
1129466750 15:75728375-75728397 TTCCCTGCAGTCTGCCCAGCTGG - Intergenic
1130273006 15:82462094-82462116 TTCCATGCAGCCAGCCCAGCAGG - Intergenic
1130465356 15:84189453-84189475 TTCCATGCAGCCAGCCCAGCAGG - Intergenic
1130487333 15:84405355-84405377 TTCCATGCAGCCAGCCCAGCAGG + Intergenic
1130498910 15:84484083-84484105 TTCCATGCAGCCAGCCCAGCAGG + Intergenic
1130587647 15:85194060-85194082 TTCCATGCAGCCAGCCCAGCAGG - Intergenic
1130850127 15:87784680-87784702 TGCACCGCAGCCTGCTGAGCTGG + Intergenic
1131001418 15:88941907-88941929 CGCCCGGCAGCCGCCCCATCCGG - Intergenic
1131479304 15:92768248-92768270 TGCCCGGCAGCCGCCCCGTCCGG - Intronic
1132621472 16:870106-870128 TGCACCCCACTCGGCCCAGCCGG - Intronic
1135127502 16:19823403-19823425 TGCCCTGCATCCCTCCCAGCAGG + Intronic
1135575663 16:23583690-23583712 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
1135694302 16:24574131-24574153 CGCCCGGCAGCCGCCCCATCCGG - Intergenic
1137694024 16:50449171-50449193 AGCCAGGCAGCCAGCCCAGCCGG + Intergenic
1138179749 16:54933244-54933266 CGCGCCGCCGCTGGCCCAGCCGG - Exonic
1138400049 16:56738265-56738287 TGTCCAGCAGAAGGCCCAGCTGG - Intronic
1138681232 16:58684775-58684797 TGTCCCGCGGCCGCCCGAGCGGG - Intronic
1139436799 16:66941168-66941190 TGCCCCGCAGGCAGCCCACCAGG - Exonic
1140063285 16:71589556-71589578 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1140093546 16:71856157-71856179 TGCCCTGCTGCCTCCCCAGCAGG + Exonic
1140753710 16:78048802-78048824 TGCCCCACAGCCGGCCAAGCGGG - Intronic
1141815224 16:86404952-86404974 TGCCCGGCATCAGGACCAGCGGG - Intergenic
1142215263 16:88826703-88826725 TGTCCATCAGCCGGCCCTGCAGG + Exonic
1142292566 16:89199741-89199763 AGCCCAGCAGCCAGCCCAGGAGG + Exonic
1142332332 16:89462866-89462888 CGCCCAGCAGCCGCCCCATCCGG + Intronic
1142431266 16:90029149-90029171 TGCCCCGTAGCCTGCCCCGTAGG - Exonic
1142431281 16:90029197-90029219 TGCCCCGTAGCCTGCCCCGTAGG - Exonic
1142705254 17:1689854-1689876 CGCCCGGCAGCCGCCCCATCCGG - Intergenic
1143115297 17:4578497-4578519 CGCCCCGCAGCCACCCCATCCGG - Intergenic
1143540106 17:7563535-7563557 GGCCCCGCCGCCGGCCCCGGTGG - Exonic
1143884793 17:10057511-10057533 CGCCCGGCAGCCGCCCCATCTGG + Intronic
1144541336 17:16145616-16145638 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
1144559796 17:16312198-16312220 CGCCCGGCAGCCGCCCCATCTGG - Intronic
1145022287 17:19441657-19441679 TGCCCGGCAGCCACCCCATCCGG + Intergenic
1146968803 17:37055672-37055694 CGCCCTGCAGAAGGCCCAGCCGG - Intronic
1147785073 17:42973159-42973181 TGCCCAGCAGCCACCCCATCCGG + Intronic
1150135537 17:62693023-62693045 CGCCCCACAGCCACCCCAGCAGG - Exonic
1151499711 17:74481033-74481055 GCCACCGCACCCGGCCCAGCTGG + Intronic
1152229259 17:79106446-79106468 TTCCCCGCCACCGTCCCAGCAGG + Intronic
1152672689 17:81618414-81618436 CGCCCCGCAGCCGCCCCGTCTGG + Intronic
1152735277 17:81994195-81994217 CGCCCCGCAGGAGGCACAGCTGG - Intronic
1152745535 17:82037049-82037071 TGCCCAGCAAGCGGCACAGCTGG + Intronic
1152784911 17:82242495-82242517 TGCCCGGCAGCAGGCCCAGGGGG + Intronic
1152869337 17:82743583-82743605 AGCACCACAGCCGACCCAGCTGG - Intronic
1154089623 18:11344794-11344816 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1154174522 18:12076669-12076691 TGCGCCGCCGCTCGCCCAGCAGG - Intergenic
1154177297 18:12093800-12093822 TGCACCTCAGCCGGCCCACGAGG - Intergenic
1155533785 18:26794915-26794937 TGCCCCACAGCCACCACAGCTGG - Intergenic
1156326305 18:36077729-36077751 TGCCCGGCAGCCACCCCATCCGG - Intergenic
1157629467 18:49080660-49080682 TGCCCGGCAGCCGCCCCGTCCGG - Intronic
1157629539 18:49080935-49080957 TTCCCCGCAGCCATCCCATCTGG - Intronic
1157867117 18:51197002-51197024 GGCCCCGGAGGCGGCCGAGCTGG - Exonic
1159614897 18:70569704-70569726 TGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1159614906 18:70569744-70569766 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
1160465455 18:79072791-79072813 TGCCCGGCAGCCACCCCATCTGG - Intronic
1160776591 19:859442-859464 TGCCCCCCACCAGGGCCAGCAGG + Intergenic
1160887039 19:1354960-1354982 AGCCCCGCCCCCGGCCCCGCGGG + Intronic
1160916588 19:1499487-1499509 TGCCCGGCAGCCACCCCATCTGG - Intergenic
1160967214 19:1752035-1752057 TGCCCTCCAGCCTGCCCAGCTGG - Intergenic
1161264783 19:3359315-3359337 CGCTCCGCAGCGAGCCCAGCCGG + Intergenic
1161346662 19:3771751-3771773 TGTCCCGCTGCCGTCCCACCAGG - Exonic
1162328086 19:10010416-10010438 CGCCCCGCAGCCGCCCCGACTGG - Exonic
1162418785 19:10553980-10554002 TCCTCCGCTGCCGGCCCAGCTGG + Exonic
1162490957 19:10991344-10991366 GGCCCTGCAGCCCGCCCACCTGG + Intronic
1162534515 19:11254857-11254879 TGCCCAGCAGGGGGCACAGCAGG + Intronic
1163334253 19:16660937-16660959 TGCCCCGCACCCCGCCTCGCTGG + Intergenic
1163500736 19:17674674-17674696 TGCGGGGCAGCCAGCCCAGCTGG - Exonic
1163699870 19:18781717-18781739 TGCCCCCCATCCTGCCCAGGAGG - Exonic
1163845361 19:19635471-19635493 GGCCCCGCAGTCGCCGCAGCTGG + Exonic
1163865526 19:19770172-19770194 TGCCCCGCCGCCACCCCATCTGG + Intergenic
1163865553 19:19770249-19770271 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
1163896473 19:20064487-20064509 TGCCCGGCAGCCACCCCATCCGG - Intergenic
1163909424 19:20176064-20176086 TGCCTGGCAGCCGCCCCATCTGG - Intronic
1164016518 19:21259948-21259970 TGCCCAGCAGCCACCCCATCTGG - Intronic
1164017398 19:21264988-21265010 TGCCCAGCTGCCGCCCCATCTGG + Intronic
1164055014 19:21614967-21614989 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
1164071829 19:21775953-21775975 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
1164244683 19:23419411-23419433 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
1164659303 19:29949147-29949169 TGCCCCACAGCCGCCCCATCTGG - Intronic
1164659316 19:29949188-29949210 CGCCCGGCAGCCGCCCCATCTGG - Intronic
1164692638 19:30222599-30222621 AGCCCCGCAGACGGCCGGGCAGG - Intergenic
1165433476 19:35784846-35784868 GGCCCCGCAGCATGCCCACCCGG - Intronic
1165434678 19:35789440-35789462 TGCGCCGCAGCAGCCCCTGCAGG + Intergenic
1165540736 19:36490879-36490901 TGCCCCGCCGCCACCCCATCTGG + Intergenic
1166191622 19:41180349-41180371 CGCCCGGCAGCCGCCCCGGCCGG + Intergenic
1166611695 19:44204086-44204108 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
1166896897 19:46028961-46028983 TGACCCGCAGCAGGCCAATCGGG - Intergenic
1166948664 19:46412438-46412460 TGCCCCGCCGCGGGCCCTGGCGG + Exonic
1167217095 19:48171821-48171843 TGCCCCGCAGCCGTGCCGGGTGG - Exonic
1167571821 19:50293253-50293275 TGCTCGGCGGCAGGCCCAGCAGG + Exonic
1168102858 19:54150180-54150202 TTCCCTGCAGCTGCCCCAGCAGG - Intronic
925987602 2:9229220-9229242 TGCCCCGCCACCAGCCCTGCAGG - Intronic
926198514 2:10777663-10777685 TGCCCCGCAGCAGGCCTATCAGG - Exonic
926215525 2:10903030-10903052 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
927154012 2:20211608-20211630 TTCCCACCAGCCGGCCCGGCTGG + Intronic
927841677 2:26448989-26449011 TGCCTCTGAGCTGGCCCAGCTGG + Intronic
928786043 2:34887588-34887610 TTCCCCGCAGCCATCACAGCTGG + Intergenic
929066106 2:37977560-37977582 CGCCCAGCAGCCGCCCCATCTGG - Intronic
929110682 2:38403533-38403555 TGCCCGGCAGCCACCCCATCCGG + Intergenic
929614500 2:43297376-43297398 TGCCCGGCAGCCACCCCATCTGG + Intronic
932306356 2:70706360-70706382 TGCCTCGCCGCCGCCCCCGCAGG - Exonic
932621724 2:73268913-73268935 CGGCCTGCAGCCGGCCCACCTGG + Exonic
933868455 2:86545493-86545515 TGCCCGGCAGTCGCCCCATCTGG - Intronic
934553486 2:95275911-95275933 TGCCCTGCTGCCTGCCCAGGTGG + Exonic
934703456 2:96461629-96461651 CGCCCCGCAGCCACCCCATCTGG + Intergenic
934933939 2:98451198-98451220 TGCCAGCCAGCCAGCCCAGCTGG + Intronic
934982043 2:98850705-98850727 TGCCCCGCAGCAGGGCCTGGAGG - Intronic
937309516 2:120893406-120893428 TGCTCAGCAGCAGGGCCAGCGGG - Intronic
937734881 2:125277138-125277160 TGCCCGGCAGCCGCCCCATCTGG - Intergenic
938055128 2:128208840-128208862 TGCCCGGCTGCCGCCCCATCTGG + Intergenic
938055257 2:128209430-128209452 TGCCCGGCTGCCGCCCCATCTGG + Intergenic
938836235 2:135106029-135106051 CGCCCGGCAGCCGCCCCATCTGG + Intronic
938836246 2:135106069-135106091 GGCCCGGCAGCCGCCCCATCCGG + Intronic
941001266 2:160205728-160205750 TGCCCCGGGGCAGGCCCAGCTGG - Intronic
943033800 2:182716181-182716203 AGACCCGCTGCGGGCCCAGCGGG - Intronic
943125758 2:183792286-183792308 TGCCCGGCAGCTGCCCCATCTGG - Intergenic
944763438 2:202840687-202840709 TGCCCTGCAGCGGGCCAAGCAGG - Intronic
946447285 2:219751052-219751074 TGCCCAGCCGCCGCCCCATCTGG - Intergenic
947188046 2:227472376-227472398 TGCCCGGCTCCCGGCCCTGCCGG + Exonic
947765311 2:232633875-232633897 TGTCCAGCCGCCGGCTCAGCTGG - Exonic
948453531 2:238093326-238093348 TGCCCCGTGGCCGGGCCTGCAGG + Intronic
948860428 2:240750202-240750224 TGCCCCGCAGTGGGCCCTGGAGG - Intronic
948903079 2:240965896-240965918 TGGAGCACAGCCGGCCCAGCTGG - Intronic
948933653 2:241149066-241149088 TTCACCGCAGCCGGCCCTGCGGG - Intronic
949045402 2:241870463-241870485 TGCCCCGCGCCCCTCCCAGCTGG - Intronic
1169125775 20:3125674-3125696 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
1170202523 20:13760552-13760574 CGCCCGGCAGCCGCCCCATCTGG + Intronic
1171070417 20:22062773-22062795 TGCTCAGCAGCTTGCCCAGCTGG - Intergenic
1171255513 20:23686600-23686622 TGCCCAGCACCCAGCCCCGCAGG + Intronic
1171463657 20:25312899-25312921 CGCCCGGCAGCCGCCCCATCTGG + Intronic
1171861253 20:30405055-30405077 TGCCCGGCAGCCACCCCATCCGG + Intergenic
1171951645 20:31427137-31427159 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1172059072 20:32176209-32176231 CGCCCGGCAGCCGCCCCATCCGG + Intergenic
1172209284 20:33185666-33185688 TGCCCCGCCGCCATCCCATCTGG - Intergenic
1173516137 20:43666937-43666959 TGTCCTGCAGCCGGCCCTGGAGG + Intergenic
1173582925 20:44160102-44160124 TGCCCAGCAGCGCGCCCCGCTGG + Exonic
1173665986 20:44763398-44763420 GGCCAGGCAGCAGGCCCAGCAGG - Intronic
1175137407 20:56834695-56834717 ACCCCCGCAACAGGCCCAGCTGG - Intergenic
1175766995 20:61598764-61598786 TGCCCCGCAGCCAGTCCCTCGGG - Intronic
1175861416 20:62152118-62152140 TGCCCAGCCTCCAGCCCAGCTGG + Intronic
1175924714 20:62466062-62466084 TCCCCCTCACCCAGCCCAGCTGG - Intronic
1177178510 21:17720608-17720630 CGCCCGGCAGCCGCCCCATCCGG - Intergenic
1177788235 21:25695499-25695521 TGCCCCGCGGCCGCCCCGTCTGG - Intronic
1178585665 21:33868598-33868620 TGCCCCGCACTCGGAGCAGCCGG - Intronic
1179195148 21:39157153-39157175 TGCCCAGCCGCCGTCCCACCTGG + Intergenic
1179492701 21:41751695-41751717 TGCCCGCCAGCCTCCCCAGCTGG - Intronic
1179664839 21:42903988-42904010 TGCCCCTCTGCCGCCCCAGGAGG - Exonic
1180796530 22:18608509-18608531 TGCTCTGCAGCAAGCCCAGCTGG + Exonic
1181225193 22:21386762-21386784 TGCTCTGCAGCAAGCCCAGCTGG - Exonic
1181253439 22:21548051-21548073 TGCTCTGCAGCAAGCCCAGCTGG + Exonic
1181598899 22:23937238-23937260 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1182564009 22:31184155-31184177 TGCCCGGCAGCCGCCCCGTCCGG - Intronic
1182616841 22:31593194-31593216 CGCCCGGCAGCCGCCCCATCTGG - Intronic
1183537227 22:38410089-38410111 TGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1183949230 22:41343476-41343498 AGCTCCGGAGCCGGCCGAGCAGG - Exonic
1184502678 22:44883259-44883281 TGCCCCTCTGGCGGGCCAGCAGG + Exonic
1185134509 22:49062155-49062177 TGCTCCGCAGCCAGCCCAGCTGG + Intergenic
949551195 3:5114046-5114068 TGCCCGGCCGCCGTCCCACCTGG - Intergenic
949988774 3:9560229-9560251 TGCCCGGCAGCCAGCCCGTCCGG + Intergenic
949989891 3:9570126-9570148 TGCCCCGCAGCCGCCCCGTCCGG + Intergenic
950110674 3:10416900-10416922 TGCCCGGCTGCCGCCCCATCTGG - Intronic
950442650 3:13019040-13019062 TGCCAAGAAGCCCGCCCAGCTGG + Intronic
950462969 3:13136063-13136085 TGTCCCGCAGGCGGCCCTGTGGG - Intergenic
950819529 3:15742574-15742596 TGCCCAGCAGCCACCCCATCCGG + Intronic
951217726 3:20040497-20040519 TGCCCCGCAGCCGCCCGGCCCGG - Exonic
951264180 3:20547931-20547953 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
952611537 3:35216058-35216080 CGCCCTGCAGCGGGCCAAGCAGG - Intergenic
952894016 3:38064654-38064676 TGCCCCGCAGCCACCCCGTCCGG - Intronic
953322277 3:41983244-41983266 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
954060322 3:48061679-48061701 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
954224885 3:49175077-49175099 TGCCCCGCAGCCTGCGCATGAGG + Exonic
954389346 3:50260634-50260656 AGCCCCGATGCCCGCCCAGCAGG + Intergenic
954481339 3:50803938-50803960 TGCCCGGCAGCCGCCCCATCTGG - Intronic
954706088 3:52481246-52481268 TGCTCAGCAGCCCTCCCAGCAGG + Intronic
954884258 3:53858084-53858106 TGGGCCGCAGCGGACCCAGCTGG + Intronic
955839472 3:63096728-63096750 CGCCCTGCAGCGGGCCAAGCAGG - Intergenic
956739046 3:72260681-72260703 TGCCAGGCAGCCAGCCCAGTGGG + Intergenic
956803822 3:72788354-72788376 TGCCCCGCCGCCACCCCATCTGG + Intronic
958406308 3:93761443-93761465 TGCCCGGCCGCCGCCCCATCTGG - Intergenic
958560864 3:95745217-95745239 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
958560874 3:95745257-95745279 CGCCCAGCAGCCGCCCCATCCGG + Intergenic
959586081 3:108026311-108026333 TGCCCGGCAGCCACCCCATCCGG - Intergenic
960770779 3:121190778-121190800 CGCCCAGCAGCCGCCCCATCTGG - Intronic
961345179 3:126259616-126259638 GGCCCCACAGCCTGACCAGCGGG + Intergenic
961449363 3:126995476-126995498 TGCCCGTCAGCCGGCCCACAGGG - Intronic
961498090 3:127309010-127309032 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
961745649 3:129062105-129062127 AGCCTGTCAGCCGGCCCAGCGGG - Exonic
962572187 3:136723529-136723551 TGCCCGGCAGCCACCCCATCCGG + Intronic
962688806 3:137872792-137872814 TGCCTGGCAGCCGCCCCATCTGG + Intergenic
962712808 3:138101837-138101859 CGCCCTGCAGCGGGCCAAGCAGG - Intronic
962787923 3:138785031-138785053 CGCCCCGCAGCCGCCCCGTCTGG + Intronic
963776412 3:149445096-149445118 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
964472320 3:157068614-157068636 TGACCTCCAGCCGGCCCAGAGGG + Intergenic
965605786 3:170496505-170496527 CGCCCTGCAGCGGGCCAAGCAGG + Intronic
966351002 3:179032759-179032781 TGCCCCGCAGCCGCCCCGTCTGG + Intronic
968156536 3:196385683-196385705 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
968341617 3:197960347-197960369 TGGCCCGGAGCCCGCCCAACAGG - Exonic
968473311 4:791700-791722 GGGGCCGCAGCAGGCCCAGCAGG - Intronic
968504705 4:966474-966496 TGTCCTGTAGCCGGTCCAGCAGG + Exonic
968650851 4:1759737-1759759 TGCACCTCAGCCTTCCCAGCTGG + Intergenic
968874964 4:3261880-3261902 TGCCCCCAAGCGGGCCCAGAGGG + Intronic
970472728 4:16393499-16393521 CGCCCGGCAGCCGCCCCATCCGG - Intergenic
971282071 4:25249536-25249558 CGCCCGGCAGCCGCCCCATCTGG - Intronic
971282085 4:25249576-25249598 CGCCCAGCAGCCGCCCCATCTGG - Intronic
972484347 4:39527644-39527666 TGCCCCGCCCCTGGCCTAGCTGG + Intronic
972790844 4:42369720-42369742 GGCCCCGCACTCGTCCCAGCCGG + Intergenic
973021222 4:45207697-45207719 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
973263369 4:48186612-48186634 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
973673167 4:53238559-53238581 CGCCCGGCAGCCGCCCCATCTGG - Intronic
974069361 4:57110198-57110220 CGCCCAGCAGGCAGCCCAGCGGG + Exonic
974848679 4:67381040-67381062 TGCCCAGCAGCCACCCCATCTGG + Intergenic
975063821 4:70037710-70037732 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
975063867 4:70037837-70037859 TGCCGGGCAGCCGCCCCATCTGG + Intergenic
975795917 4:78007165-78007187 CGCCCGGCAGCCGGCCCGTCTGG - Intergenic
976976220 4:91168467-91168489 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
977928664 4:102729078-102729100 CGCCCTGCAGCAGGCCAAGCAGG - Intronic
979482881 4:121238697-121238719 TGCCCGGCAGCCACCCCATCTGG + Intergenic
979622414 4:122812109-122812131 TGCCCGGCAGCCGACCCGTCCGG + Intergenic
979641615 4:123016280-123016302 TGCCCGGCAGCCACCCCATCCGG - Intronic
981993695 4:150954119-150954141 TGCCCGGCAGCCGCCCCGTCGGG + Intronic
982182873 4:152765399-152765421 CGCCCGGCAGCCGCCCCATCCGG - Intronic
983613741 4:169679089-169679111 CGCCCGGCAGCCGCCCCATCTGG - Intronic
984004936 4:174295145-174295167 TGCCCGGCAGCCACCCCATCCGG - Intronic
985216373 4:187658173-187658195 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
985575027 5:669996-670018 TGCCCCAAAGCCGGCCCAGCAGG + Intronic
985716689 5:1467000-1467022 TGTCCAGCCGCCGGCCCTGCAGG - Intronic
985733187 5:1563061-1563083 TTCCCCGCAGCAGCTCCAGCTGG + Intergenic
985783804 5:1883903-1883925 TCCCTCGCAGCCAGCCCTGCGGG - Intronic
987050555 5:14144065-14144087 TGTCCCGCTGCCCGCGCAGCCGG + Intronic
988161499 5:27523674-27523696 ACCCCCTCGGCCGGCCCAGCAGG + Intergenic
988532881 5:32041038-32041060 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
989633511 5:43511318-43511340 TGCCCGGCAGCCGCCCCGTCCGG + Intronic
989663462 5:43824564-43824586 TGCCCAGCAGCTGCCCCATCTGG - Intergenic
989663471 5:43824604-43824626 TGCCCAGCAGCCGCCCCATCTGG - Intergenic
990293883 5:54381459-54381481 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
990427083 5:55697033-55697055 TGCCCCGCCGCCATCCCATCTGG - Intronic
990459084 5:56015131-56015153 TGCCCGGCAGCCGCCCCGTCCGG - Intergenic
991963251 5:72066190-72066212 TGCCCAGCAACAGGCCCTGCTGG - Intergenic
992391685 5:76336167-76336189 TGCCCGGCAGCCACCCCATCCGG - Intronic
992415805 5:76551084-76551106 CGCCCCGCAGCCGCCCCGTCTGG - Intronic
993934733 5:93986296-93986318 CGCCCAGCAGCCGCCCCATCTGG + Intronic
994320796 5:98392433-98392455 TGCCCCGCAGCCGGCCCAGCAGG - Intergenic
994517173 5:100785769-100785791 TGCCTGGCAGCCGCCCCATCTGG + Intergenic
995421085 5:111967664-111967686 TGCCCAGCTGCCGCCCCATCTGG + Intronic
995942333 5:117599902-117599924 TGCCCGGCAGCCACCCCATCCGG - Intergenic
996054124 5:118965197-118965219 CGCCCAGCAGCCGCCCCATCTGG + Intronic
996057670 5:118999058-118999080 TGCCCCGCCGCCACCCCATCTGG + Intergenic
996057706 5:118999175-118999197 CGCCCAGCAGCCGCCCCATCTGG + Intergenic
996159885 5:120148138-120148160 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
996432902 5:123401248-123401270 CGCCCTGCAGCGGGCCAAGCAGG - Intronic
996716173 5:126589831-126589853 TGCCCAGCTGCCGCCCCATCTGG + Intronic
997198617 5:131996044-131996066 TGCCCTGCAGATGGCACAGCAGG + Intronic
997201355 5:132011774-132011796 TGCCCTGCAGCCTGGCCGGCCGG + Intronic
997589805 5:135065699-135065721 TGCCCCGGAGCAAGCCCAGAAGG - Intronic
998021850 5:138777016-138777038 TGCCCGGCAGCCACCCCATCCGG - Intronic
998040651 5:138949131-138949153 TTCCCAGCACCCGGCACAGCAGG + Intronic
999455635 5:151714044-151714066 CGCCCCGCAGCCGCCCCGTCCGG - Intergenic
999963511 5:156783221-156783243 TGCCCCTCCCCCGGCCAAGCTGG - Intergenic
1000630209 5:163583704-163583726 CGCCCGGCAGCCGCCCCATCCGG - Intergenic
1001010425 5:168092806-168092828 TGCACAGCAGCTGGCTCAGCTGG + Intronic
1001342778 5:170862398-170862420 CGCGCCAAAGCCGGCCCAGCTGG - Intronic
1001419202 5:171573973-171573995 TGGCCGGCAGCCGGGCCACCCGG + Intergenic
1002071321 5:176680352-176680374 CGCCCGGGAGCCGGCCCAGGCGG - Intergenic
1002626167 5:180531223-180531245 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1003603993 6:7542713-7542735 GGCCCGGCAGCCGCCCCGGCGGG - Intronic
1005414466 6:25586153-25586175 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1006064781 6:31454958-31454980 TGCCCGGCAGCCGCCCCATCCGG - Intergenic
1006065057 6:31455613-31455635 CGCCCAGCAGCCGCCCCATCCGG - Intergenic
1006128516 6:31854525-31854547 CGCCCCGCAGCCACCCCATCTGG - Intergenic
1006514488 6:34538405-34538427 TGCCCCACAGCCGGGCCACCTGG + Exonic
1006860883 6:37170804-37170826 TGCCCAGTAGCGGGCCCACCTGG - Exonic
1007236681 6:40395470-40395492 TGCCCAGCAGATGGCCTAGCAGG - Intronic
1007505670 6:42333535-42333557 TGCCCTGCACCCTGCGCAGCTGG + Intronic
1008148588 6:47922434-47922456 AGCCCCCCTGCCGGCCCAACTGG + Intronic
1008629347 6:53348633-53348655 TACCCCGGAGCCGGCGGAGCTGG + Intronic
1008909931 6:56721162-56721184 CGCCCGGCAGCCGCCCCATCTGG - Intronic
1009042050 6:58190830-58190852 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1009599236 6:65776633-65776655 TGCCCCTCACCCCGCTCAGCTGG + Intergenic
1009622679 6:66096859-66096881 TGCCCGGCAGCCGCCCCATCCGG - Intergenic
1010300611 6:74255124-74255146 TGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1010300715 6:74255552-74255574 TGCCCGGCCGCCGCCCCATCTGG - Intergenic
1011717889 6:90125993-90126015 TTCCCTGCAGCCGGCCCTCCTGG - Intronic
1011898660 6:92264032-92264054 TGCACTACAGCCGGACCAGCTGG - Intergenic
1013681316 6:112528405-112528427 TGCCCGGCAGCCACCCCATCCGG - Intergenic
1013800095 6:113932150-113932172 TGCCCCGCCGCCACCCCATCTGG + Intergenic
1015525970 6:134175518-134175540 AGCGCCGCCGCCGGCCCCGCTGG - Intronic
1015539183 6:134297328-134297350 CGCCCTGCAGCGGGCCTAGCAGG - Intronic
1015921276 6:138268936-138268958 AGCCCCTCAGCCTGCCTAGCAGG + Intronic
1017063420 6:150507455-150507477 TGCCCCGCGGCCACCCCATCTGG + Intergenic
1017324579 6:153130965-153130987 CGCCGCGCAGCCGCCCCCGCCGG + Intronic
1017737810 6:157380588-157380610 GGCCCGGAAGCCGGCCGAGCCGG + Intergenic
1017855766 6:158349278-158349300 TGACCGGCAGCCGCCCCATCTGG - Intronic
1017982008 6:159407676-159407698 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1018613025 6:165662093-165662115 TTCCCCGGCGCCGGCCCAGGCGG - Intronic
1019287771 7:232107-232129 TGCTCGGCCGCCGGCCCAGCTGG + Intronic
1019473405 7:1232982-1233004 CGCCCCGCCACCGGCCCCGCCGG + Exonic
1019530043 7:1498840-1498862 GGCCCCGCAGCTGACCCGGCCGG - Exonic
1019634071 7:2066265-2066287 TGCATGGCAGCCCGCCCAGCTGG - Intronic
1019729615 7:2622882-2622904 TGCCAGGCTGCAGGCCCAGCTGG + Intergenic
1021452962 7:20798594-20798616 GGCCGCGCAGGCTGCCCAGCAGG - Intergenic
1022318102 7:29263861-29263883 CGCCCGGCAGCCGCCCCATCTGG + Intronic
1024269056 7:47628557-47628579 GGCCCCGCACCCGGAGCAGCCGG + Intergenic
1024538700 7:50459754-50459776 TGCCCGGCAGCCACCCCATCCGG + Intronic
1026163565 7:67890501-67890523 TGCCCGGCCGCCGCCCCATCTGG + Intergenic
1026186187 7:68083483-68083505 TGCCCGGCAGCTGCCCCATCTGG + Intergenic
1026951731 7:74351994-74352016 AGGCCAGCAGCCAGCCCAGCTGG + Intronic
1027371072 7:77509209-77509231 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1027826780 7:83125321-83125343 CGCCCGGCAGCCGCCCCATCTGG + Intronic
1032028659 7:128463617-128463639 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1032156868 7:129476255-129476277 TGCCCGGCAGCCGCCCCGCCCGG - Intronic
1032418294 7:131755982-131756004 TGCCCGGCCGCCGCCCCATCTGG - Intergenic
1032418306 7:131756022-131756044 TGCCCGGCCGCCGCCCCATCTGG - Intergenic
1032418328 7:131756099-131756121 TGCCCGGCCGCCGCCCCATCTGG - Intergenic
1033294084 7:140114968-140114990 CGCCCGGCAGCCGCCCCATCCGG + Intronic
1033299949 7:140176704-140176726 AGCCCCGCAGCCGCCACCGCCGG - Intronic
1034940140 7:155225335-155225357 TGCCCCGCAGCTGATGCAGCGGG + Intergenic
1035259611 7:157653107-157653129 TGCCCCCCAGACGGTGCAGCCGG + Intronic
1036195189 8:6708180-6708202 GCGTCCGCAGCCGGCCCAGCTGG + Intergenic
1036536748 8:9657799-9657821 CGCCCGGCAGCCGCCCCATCCGG - Intronic
1037134587 8:15446005-15446027 CGCCCGGCAGCCGGCCCGTCTGG - Intronic
1037263863 8:17037098-17037120 GGCCCCGCAGTCGGAGCAGCCGG - Intronic
1037362024 8:18084110-18084132 TGGCCTGCCCCCGGCCCAGCCGG - Intronic
1039650897 8:39339214-39339236 CGCCCAGCAGCCGCCCCATCCGG - Intergenic
1039650910 8:39339254-39339276 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
1040041327 8:42919142-42919164 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1040093324 8:43419595-43419617 TGCCCGGCAGCCGCCCAATCTGG - Intergenic
1040916995 8:52573605-52573627 TGCCCGGCAGCCGCCCCATCTGG - Intergenic
1040917004 8:52573645-52573667 TGCCCGGCAGCTGCCCCATCTGG - Intergenic
1040951248 8:52940582-52940604 TGGCATGCAGCCGGCACAGCAGG - Exonic
1041362921 8:57071479-57071501 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
1041513595 8:58676488-58676510 CGCCCAGCAGCCGCCCCATCTGG - Intergenic
1041781151 8:61579293-61579315 TGCCCTGCAGCGGGCCAAGCAGG + Intronic
1042290716 8:67167455-67167477 CGCCCAGCAGCCGCCCCATCCGG - Intronic
1043865012 8:85364873-85364895 TGCCCCTCAGCTGGCACTGCAGG - Intronic
1044969445 8:97605153-97605175 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1044996294 8:97841020-97841042 TGCCCAGCCGCCGCCCCATCTGG - Intronic
1045021933 8:98051872-98051894 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1045195650 8:99927340-99927362 CGCCCGGCAGCCGCCCCATCTGG + Intergenic
1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG + Intergenic
1047202985 8:122781971-122781993 AGCCCCCCAGCCGGCGCCGCCGG + Intronic
1047266575 8:123314769-123314791 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1048321467 8:133403754-133403776 TGCACCGCCCCCAGCCCAGCAGG - Intergenic
1049714220 8:144082359-144082381 TGCCCGACAGCAGGCCGAGCTGG - Intergenic
1050862326 9:10449713-10449735 TGCCCGGCAGCCACCCCATCTGG + Intronic
1052274925 9:26664681-26664703 TGCCCGGCAGCCACCCCATCTGG + Intergenic
1052731460 9:32291228-32291250 TGCCCCACAGCAGCCCCAGCAGG - Intergenic
1052928714 9:34039117-34039139 CGCCCGGCAGCCGGCCCGTCTGG + Intronic
1053165449 9:35841041-35841063 TTCTCCCCAGCCCGCCCAGCAGG + Intronic
1055297993 9:74853208-74853230 CGCCCGGCAGCCGCCCCATCGGG + Intronic
1055298018 9:74853288-74853310 CGCCCGGCAGCCGCCCCATCCGG + Intronic
1057186265 9:93058970-93058992 CGACCCTCCGCCGGCCCAGCAGG + Intronic
1057630479 9:96715718-96715740 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
1057943661 9:99306233-99306255 CGCCCTGCAGCGGGCCAAGCAGG + Intergenic
1058722526 9:107776193-107776215 TGCCCAGCAGCCACCCCATCTGG + Intergenic
1059879925 9:118678207-118678229 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
1060221305 9:121765464-121765486 GGCCCAGCAGCCTGCTCAGCAGG - Intronic
1060687059 9:125623633-125623655 TGCCCAGCAGCCACCCCATCTGG + Intronic
1061234493 9:129334598-129334620 TGCCCGGCAGGCAGCCCAGCCGG - Intergenic
1061411075 9:130422081-130422103 TGCCCTGCAGCTGGCCTGGCCGG - Intronic
1061725594 9:132580483-132580505 GGCCCCGCCGCCGGCCGGGCTGG - Intergenic
1061858508 9:133456002-133456024 AGCCCCGGAGCCTGCCCTGCTGG + Intronic
1061986924 9:134135489-134135511 AGCCCGGCAGCCGGCCCCGCGGG + Intronic
1062305939 9:135907253-135907275 GGCCCCGCAGCCGGCCAGCCGGG + Intergenic
1062421518 9:136484628-136484650 TCACCAGCCGCCGGCCCAGCTGG - Exonic
1185462112 X:338248-338270 GGCCCTGCAGCCTGCCCAGCAGG + Intronic
1190114893 X:47619938-47619960 CGCGCCGCCGCCGGCCCAGCCGG - Intergenic
1190159043 X:48017061-48017083 CGCCCGGCAGCCGCCCCATCTGG + Intronic
1190769620 X:53504205-53504227 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1190906828 X:54736593-54736615 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1190906837 X:54736633-54736655 TGCCCAGCAGCCGCCCTATCCGG + Intergenic
1191220773 X:57985755-57985777 TGCCCTGCAGCGGGCCAAGCAGG + Intergenic
1191618196 X:63189854-63189876 TGCCCGGCAGCCACCCCATCTGG - Intergenic
1191894216 X:65975396-65975418 CGCCCGGCAGCCGCCCCATCAGG - Intergenic
1191894251 X:65975513-65975535 TGCCCGACAGCCGCCCCATCTGG - Intergenic
1192260799 X:69504995-69505017 TGCCCCGCACCGCCCCCAGCCGG + Intergenic
1192261503 X:69508517-69508539 TGCCCTTCTGCCGGCACAGCAGG - Intronic
1192350078 X:70349490-70349512 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1192761306 X:74098527-74098549 TGCCCGGCAGCTGCCCCATCTGG + Intergenic
1192892615 X:75407287-75407309 CGCCCAGCAGCCGTCCCATCTGG + Intronic
1193585073 X:83311335-83311357 TGCCCCACAGCTGTCACAGCTGG - Intergenic
1193924367 X:87466110-87466132 TGCCCGGCAGCCGCCCCATCTGG + Intergenic
1194714669 X:97275476-97275498 CGCCCGGCAGCCGCCCCATCTGG - Intronic
1194788719 X:98118971-98118993 TGCCCCATAGCCAGCACAGCTGG - Intergenic
1195888939 X:109671305-109671327 TGCCCCGCCGCCGCCCCGTCTGG + Intronic
1197735935 X:129850619-129850641 TGCCCGGCAGCCACCCCATCCGG + Intergenic
1198108639 X:133483889-133483911 CGCCCGGCAGCCGCCCCATCTGG - Intergenic
1198233582 X:134716021-134716043 TGGGCAGCAGCAGGCCCAGCTGG + Intronic
1198476556 X:137000826-137000848 TGCCCGGCAGCCACCCCATCCGG - Intergenic
1200098238 X:153674018-153674040 GGCCCTGGGGCCGGCCCAGCCGG - Exonic
1201948264 Y:19535722-19535744 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1202101593 Y:21314289-21314311 GCCACCGCAGCCGGCCCAGAAGG - Intergenic