ID: 994320796

View in Genome Browser
Species Human (GRCh38)
Location 5:98392433-98392455
Sequence TGCCCCGCAGCCGGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 520}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994320796_994320802 5 Left 994320796 5:98392433-98392455 CCTGCTGGGCCGGCTGCGGGGCA 0: 1
1: 0
2: 3
3: 37
4: 520
Right 994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG 0: 1
1: 0
2: 11
3: 24
4: 66
994320796_994320803 17 Left 994320796 5:98392433-98392455 CCTGCTGGGCCGGCTGCGGGGCA 0: 1
1: 0
2: 3
3: 37
4: 520
Right 994320803 5:98392473-98392495 CTTGCGGTTGGCATCCTTAACGG 0: 1
1: 0
2: 9
3: 18
4: 55
994320796_994320800 1 Left 994320796 5:98392433-98392455 CCTGCTGGGCCGGCTGCGGGGCA 0: 1
1: 0
2: 3
3: 37
4: 520
Right 994320800 5:98392457-98392479 CCTCCAGCTCGGACAGCTTGCGG 0: 1
1: 1
2: 1
3: 16
4: 124
994320796_994320798 -10 Left 994320796 5:98392433-98392455 CCTGCTGGGCCGGCTGCGGGGCA 0: 1
1: 0
2: 3
3: 37
4: 520
Right 994320798 5:98392446-98392468 CTGCGGGGCAGCCTCCAGCTCGG 0: 1
1: 3
2: 13
3: 49
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994320796 Original CRISPR TGCCCCGCAGCCGGCCCAGC AGG (reversed) Intergenic