ID: 994320797

View in Genome Browser
Species Human (GRCh38)
Location 5:98392442-98392464
Sequence GCTGGAGGCTGCCCCGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 5, 2: 22, 3: 71, 4: 294}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994320797_994320805 29 Left 994320797 5:98392442-98392464 CCGGCTGCGGGGCAGCCTCCAGC 0: 1
1: 5
2: 22
3: 71
4: 294
Right 994320805 5:98392494-98392516 GGACAGCTCCCCACTCTGCTCGG 0: 1
1: 0
2: 7
3: 28
4: 196
994320797_994320802 -4 Left 994320797 5:98392442-98392464 CCGGCTGCGGGGCAGCCTCCAGC 0: 1
1: 5
2: 22
3: 71
4: 294
Right 994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG 0: 1
1: 0
2: 11
3: 24
4: 66
994320797_994320803 8 Left 994320797 5:98392442-98392464 CCGGCTGCGGGGCAGCCTCCAGC 0: 1
1: 5
2: 22
3: 71
4: 294
Right 994320803 5:98392473-98392495 CTTGCGGTTGGCATCCTTAACGG 0: 1
1: 0
2: 9
3: 18
4: 55
994320797_994320800 -8 Left 994320797 5:98392442-98392464 CCGGCTGCGGGGCAGCCTCCAGC 0: 1
1: 5
2: 22
3: 71
4: 294
Right 994320800 5:98392457-98392479 CCTCCAGCTCGGACAGCTTGCGG 0: 1
1: 1
2: 1
3: 16
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994320797 Original CRISPR GCTGGAGGCTGCCCCGCAGC CGG (reversed) Intergenic
900108472 1:996197-996219 GGTGGCGGCTGCTCAGCAGCTGG - Intergenic
900243172 1:1626345-1626367 GCTGTACGCTGACCAGCAGCAGG - Intronic
900298650 1:1965620-1965642 GGAGGAGGCTGCCCGGCTGCCGG - Intronic
900476608 1:2879176-2879198 GCTGGATTCTGGGCCGCAGCAGG + Intergenic
900524044 1:3119883-3119905 CCTGGGGGCTGCCCCTCTGCAGG - Intronic
900642800 1:3695413-3695435 GCTGGAGCCTGTCTCGCCGCAGG + Intronic
901131187 1:6963149-6963171 GCTGGAGCCTGCCAAGGAGCTGG - Intronic
902326182 1:15702249-15702271 CCTGGAGGCTGCCCCTCACATGG - Intronic
902657488 1:17879336-17879358 GCTGGTGGCTGCCTCGAAGTTGG - Intergenic
902761136 1:18581459-18581481 GCTGGAGGTGGCCCAGGAGCAGG - Intergenic
906223696 1:44103690-44103712 GCTGGAGGCCGCCCTCCAGCCGG - Intergenic
906507921 1:46393998-46394020 GCTGAAGACTGCGCCCCAGCCGG - Intergenic
906695185 1:47818668-47818690 GCAGGAGGCTGTCCCTCACCAGG + Intronic
906931919 1:50178124-50178146 GCTGGCAGCTGCCCCTAAGCAGG - Intronic
907248004 1:53120386-53120408 CCTGCAGGCTGCCCAGCTGCCGG + Intronic
907248611 1:53123310-53123332 CCTGGAGTCTGCCCCGCACAGGG + Intronic
907329869 1:53663809-53663831 GCCTGGGGCTGCCCCGCCGCTGG - Intronic
909232288 1:73105897-73105919 GCTGGAGGCCGCCGTGTAGCAGG + Intergenic
910449008 1:87328571-87328593 GCTGGAGCCTGCGCCGCTGCCGG - Exonic
913048041 1:115089885-115089907 GTCGGAGGTTGCCCCGAAGCTGG + Intergenic
914852814 1:151327411-151327433 GCCGCGGGCAGCCCCGCAGCCGG - Exonic
914932812 1:151949876-151949898 GCTGGAGGCCACCCTGCAGTGGG - Intergenic
915619818 1:157074317-157074339 GCTGGAGGCCGCCCTGCAGCGGG + Intergenic
916792566 1:168136879-168136901 GCTGGTGGCTGGCCCGCGGGAGG - Intronic
917838361 1:178958472-178958494 GCTGGAGGCATCTCCTCAGCAGG + Intergenic
921090493 1:211837502-211837524 GCTGTAGGCTTCCCAGCAGCTGG - Intergenic
923035126 1:230280258-230280280 TCTGGAGGAAGCCCCCCAGCTGG - Exonic
923199056 1:231694231-231694253 GCTGCAGGCTGCCTCCCAGCTGG - Exonic
923782989 1:237042396-237042418 GCTGGAGGGGGCCGCGCTGCCGG - Exonic
924088469 1:240478506-240478528 GCTGAAATGTGCCCCGCAGCAGG - Intergenic
924545230 1:245020277-245020299 GCTGGTGGCTGCCCAGCATTTGG - Intronic
924732567 1:246724939-246724961 GCTTCATCCTGCCCCGCAGCGGG + Intronic
924797176 1:247300806-247300828 GCTGGAGTCTGTCCGGCTGCAGG + Exonic
1062774252 10:132496-132518 TTTGAGGGCTGCCCCGCAGCAGG + Intergenic
1063631167 10:7735051-7735073 GCTGGCGGATGCCCCACCGCAGG + Exonic
1063714534 10:8514051-8514073 GCTGGAGGCCGCCCTGCAGCGGG - Intergenic
1065047779 10:21759394-21759416 GCTGGAGGCTACAGCGAAGCCGG - Exonic
1065482753 10:26211998-26212020 GCTGGAGCCTGCGGGGCAGCAGG + Exonic
1066986823 10:42475641-42475663 GCTGGAGGCTGCTCCGCCGTGGG + Intergenic
1067570122 10:47365413-47365435 GCAGGAGGCTGCCATGCAGCTGG - Intergenic
1067842209 10:49690058-49690080 GCTGAAGGCTTCCCTGCAGGAGG + Intronic
1068689909 10:59905269-59905291 CCTGGAGGCTGCCCAGAAACGGG - Intronic
1070102123 10:73398249-73398271 GCTGGAGGCTACCCTGCGCCTGG - Exonic
1070597417 10:77842249-77842271 GCGGGAGGCAGCAGCGCAGCCGG - Intronic
1073045802 10:100637637-100637659 GCTGGAGGCTGCCACTCTGGAGG - Intergenic
1075646692 10:124101433-124101455 GCAGGTGGCTGCCCCCCATCAGG + Intergenic
1075856957 10:125637932-125637954 GTTGGAGGGGGCCCGGCAGCAGG - Intronic
1076117057 10:127907789-127907811 CCAGGATGCTGCCCCGCAGCCGG + Intronic
1076566696 10:131404068-131404090 GCTGGAGGAAGCCCCCCAGTAGG + Intergenic
1076679252 10:132163232-132163254 GCTGTATGATGCCCTGCAGCAGG + Exonic
1077050068 11:562602-562624 CCTGGAGGCTGAGCTGCAGCTGG + Exonic
1077365684 11:2160678-2160700 GCAGGAGGCTGCCACCCAGCAGG - Intronic
1077433547 11:2527565-2527587 GCTGGTGGCTGCCCCAGGGCGGG - Intronic
1077511072 11:2963433-2963455 GCTGGGGGCTGCCCTCCAGAGGG - Intronic
1077730324 11:4723099-4723121 GCTGGAGGCCGCCCTGCAGCGGG - Intronic
1078191536 11:9095546-9095568 GCTGGAGGCCGCCCTGCAGCGGG + Intronic
1078467893 11:11563650-11563672 GCTGGTGGGGGCCCCACAGCCGG + Intronic
1078859825 11:15236636-15236658 GGTGGTGGCTGCCTTGCAGCTGG + Intronic
1081667563 11:44925452-44925474 CCTGGAGGCTGACCAGGAGCTGG - Intronic
1082657691 11:55872921-55872943 GCCGCAAGCTGCTCCGCAGCAGG + Intergenic
1083191176 11:61053381-61053403 GCTGGTGGCTGCCCCTCTGTGGG + Intergenic
1083593243 11:63907298-63907320 GCAGGGGGCTGCCCCACAGGGGG + Intronic
1083714555 11:64568055-64568077 GCAGGAGGCTGCCTTGCGGCTGG + Intronic
1083913954 11:65727973-65727995 GCTGGAGGCTGCCCTGTAGCAGG + Intergenic
1083924040 11:65795314-65795336 GGTGGGGGCTGCCCTGCAGCAGG - Exonic
1084065091 11:66699467-66699489 CCTGGAGGCTGGCCGCCAGCTGG - Exonic
1084112555 11:67023401-67023423 GCGGGAGGCGGGCCGGCAGCTGG + Intronic
1084630089 11:70342248-70342270 GCTTGAGGCTGCTGCCCAGCAGG + Intronic
1087012845 11:93529783-93529805 GGCGGAGGCTGGCCCTCAGCGGG - Intronic
1088619911 11:111671318-111671340 GCTGGAGGCCGCCCTGCAATGGG - Intronic
1088798896 11:113287827-113287849 CCTGGAGGCTACACCACAGCAGG - Intergenic
1089286834 11:117412789-117412811 GCTGGGGGCTGTCCCTCTGCAGG + Exonic
1089599219 11:119603219-119603241 GCTGGAGGCCGCCCAGGAGCGGG - Intergenic
1089782721 11:120884814-120884836 GCTGGAAGCTGGCTCACAGCAGG - Intronic
1091154480 11:133360993-133361015 GCCGTGGGCAGCCCCGCAGCCGG - Intronic
1091204444 11:133810114-133810136 GCTGGAGGCCGCCCCAAAGACGG - Intergenic
1091357581 11:134949474-134949496 GCTGGAGGCAGCTTGGCAGCTGG + Intergenic
1094699065 12:32850946-32850968 GCTTGAGGATGCCACGAAGCTGG + Exonic
1096518722 12:52172313-52172335 GCTGGAGGCCGCCCTGCAGCAGG - Exonic
1096531507 12:52245495-52245517 GCTGGAAGCCGCCCTGCAGCGGG + Exonic
1096532773 12:52252376-52252398 GCTGGAGGGTGCCCTGCAGAAGG - Intronic
1096537929 12:52287217-52287239 GCTGGAGGGCGCCCTGCAGAAGG - Exonic
1096540842 12:52306143-52306165 GCTGGAGGGTGCCCTGCAGAAGG + Exonic
1096542528 12:52316008-52316030 GCTGGAGGGCGCCCTGCAGAAGG - Exonic
1096547415 12:52350196-52350218 GCTGGAGGACGCCCTGCAGAAGG + Intergenic
1096549395 12:52362366-52362388 GCTGGAGGGCGCCCTGCAGAAGG - Exonic
1096552203 12:52380478-52380500 TCTGGAGTGTGCCCTGCAGCAGG - Exonic
1096562674 12:52447893-52447915 GCTGGAGGATGCCCTGCAGAAGG - Exonic
1096564844 12:52469785-52469807 GCTGGAGGATGCCCTGCAGAAGG - Exonic
1096566764 12:52488443-52488465 GCTGGAGGATGCCCTGCAGAAGG - Exonic
1096569952 12:52516752-52516774 GCTGGAGGAGGCCCTGCAGAAGG - Exonic
1096574862 12:52546401-52546423 GCTGGAGGGCGCCCTGCACCAGG - Exonic
1096578267 12:52568284-52568306 GCTGGAGGGCGCCCTGCACCAGG - Exonic
1096581383 12:52587746-52587768 GCTGGAGGGCGCCCTGCACCAGG - Exonic
1096584435 12:52610730-52610752 GCTGGAGGGCGCCCTGCAGCAGG - Exonic
1096589307 12:52646855-52646877 CCTGGAGGAGGCCCTGCAGCAGG - Exonic
1096593262 12:52676390-52676412 CCTGGAGGATGCCCTGCAGCAGG - Exonic
1096609448 12:52791321-52791343 GCTGCAGGCTGCTCTACAGCAGG - Exonic
1096611933 12:52807759-52807781 GCTGGAGGCTGCCCTGCAGCAGG - Exonic
1096626429 12:52898794-52898816 GCTGGAGGCCGCCCTGCAGCGGG - Exonic
1097615576 12:61880387-61880409 GCTGGAGGCCGCCCTGCAGTGGG + Intronic
1101469823 12:104986191-104986213 CCTGGAGGCTGCGCGGGAGCAGG - Intergenic
1102678115 12:114672210-114672232 GCTGGAGGCTGCCGCAGAGGAGG + Exonic
1103916592 12:124378923-124378945 CTTGGAGGCTGCCCTGCCGCTGG + Intronic
1103945782 12:124525638-124525660 CATGGAGGCTGTCCCACAGCTGG + Intronic
1104178336 12:126353766-126353788 GCTGCAGGCTGCCCCTCATGTGG + Intergenic
1107449713 13:40497478-40497500 GCTGTCTGCCGCCCCGCAGCTGG + Intergenic
1110706213 13:78603437-78603459 GCTGGCGGCGGCCCCGCCGCGGG + Exonic
1111224169 13:85247812-85247834 TATGCAGGCTGCCCAGCAGCAGG + Intergenic
1113611195 13:111645995-111646017 GGTGGACGCTGCCCGGCAGCTGG + Intronic
1115854060 14:37611090-37611112 GTCCGAGGCTGCCCCGGAGCGGG + Intronic
1116326896 14:43541240-43541262 GCTGGTGGCTGCCCTACAGCGGG - Intergenic
1119474909 14:74921536-74921558 GCTCATGGCTGCCCTGCAGCTGG + Exonic
1121311013 14:92934979-92935001 GCTGGAGGCTGCCTCCCTACCGG - Exonic
1121334710 14:93070226-93070248 GCTGGAGGGGGCCCGGCAGCAGG + Intronic
1121640708 14:95483112-95483134 GACGGAGGCTGCCTGGCAGCTGG - Intergenic
1122286628 14:100656155-100656177 ACTGGAGGCTATCCTGCAGCAGG - Intergenic
1122436759 14:101706114-101706136 GCTGGAGGCTGAGCCGCCGCAGG + Intergenic
1122961451 14:105095626-105095648 ACTGGAGGCAGCTCTGCAGCAGG - Intergenic
1202849808 14_GL000225v1_random:9395-9417 CCCGGAGGCCTCCCCGCAGCAGG + Intergenic
1202868114 14_GL000225v1_random:136042-136064 CCCGGAGGCCTCCCCGCAGCAGG - Intergenic
1123458458 15:20446487-20446509 GCTGCAGGCTGGCCCTCAGCTGG + Intergenic
1123464559 15:20505967-20505989 GCCCGAGGCTGCCCCGCGGGTGG + Intergenic
1123653555 15:22495074-22495096 GCCCGAGGCTGCCCCGCGGGTGG - Intergenic
1123659605 15:22553922-22553944 GCTGCAGGCTGGCCCTCAGCTGG - Intergenic
1123743975 15:23303934-23303956 GCCCGAGGCTGCCCCGCGGGTGG - Intergenic
1124264752 15:28222656-28222678 GCTGCAGGCTGGCCCTCGGCTGG + Intronic
1124275288 15:28321934-28321956 GCCCGAGGCTGCCCCGCGGGTGG + Intronic
1124307416 15:28589667-28589689 GCCCGAGGCTGCCCCGCGGGTGG - Intergenic
1124313468 15:28648417-28648439 GCTGCAGGCTGGCCCTCAGCTGG - Intergenic
1124376973 15:29134552-29134574 GCTGTAAGGTGCCCCGCACCTGG - Intronic
1125504417 15:40258730-40258752 GCTGGAGGAAGCCCCACAGCAGG + Intronic
1125724750 15:41862550-41862572 GCTGGTGGCAGCTCCGGAGCAGG - Exonic
1126467324 15:48972969-48972991 GCTGGAGGCCGCCCAGCAGCGGG + Intergenic
1128160651 15:65421443-65421465 GCTGGAGGCCGCCGCGAGGCTGG - Intronic
1128258769 15:66217303-66217325 GCTGGAGGCTGTCCCTGCGCAGG - Intronic
1129296422 15:74602661-74602683 CCTGGAGGCTGCCCAGGACCAGG - Intronic
1129597921 15:76979365-76979387 GCTGGAGGCCGCCCTGCGGCAGG - Intergenic
1129712015 15:77825286-77825308 GCTGGAGGCAGCAGGGCAGCAGG + Intergenic
1132344594 15:101100740-101100762 TCTGCAGGCTGCCCCGTGGCTGG + Intergenic
1132720263 16:1312194-1312216 GCTGGAGGCAGCCCCAGACCGGG - Intronic
1132779530 16:1614849-1614871 CCTGGGGGCTGCCCTGCGGCGGG - Exonic
1132838925 16:1968826-1968848 GCTGGAGGGTGCCCCACAGGAGG + Exonic
1132840769 16:1977594-1977616 TCTGGGGGCTGCACTGCAGCCGG + Exonic
1133302073 16:4788416-4788438 CCTGGAGGCTTCTCTGCAGCAGG + Exonic
1134070001 16:11255154-11255176 GCTGGCGGCTGTCGCGCACCAGG + Exonic
1134250363 16:12569715-12569737 CCTGGGGGCTGCCCAGCTGCTGG - Exonic
1135383042 16:22009296-22009318 GTTGCAGGCAGCCCGGCAGCGGG + Intronic
1136156109 16:28383331-28383353 CCTGCAGGCTGCGCAGCAGCAGG + Exonic
1136206977 16:28731957-28731979 CCTGCAGGCTGCGCAGCAGCAGG - Exonic
1136286808 16:29248934-29248956 ACTGGACGCTGGCCCGCAGCCGG - Intergenic
1136534977 16:30893972-30893994 ACGGGAGGCGGCCCCGCCGCGGG - Exonic
1136588428 16:31202417-31202439 GCTGCAGGCGGCCACGCACCAGG - Exonic
1138504878 16:57473316-57473338 ACTGCAGCCAGCCCCGCAGCAGG + Exonic
1139710238 16:68770492-68770514 GCTGGTGCCTGGCCCACAGCAGG - Intronic
1140753712 16:78048811-78048833 CTGGGAGGCTGCCCCACAGCCGG - Intronic
1141143120 16:81510158-81510180 GAGGGTGGCAGCCCCGCAGCAGG - Intronic
1141405967 16:83793396-83793418 ACTGGAGCCAGCCCCGCAGCTGG + Intronic
1141503299 16:84459425-84459447 CCTGGAGGAAGCCCCGCAGGTGG - Intronic
1142092406 16:88221569-88221591 ACTGGACGCTGGCCCGCAGCCGG - Intergenic
1142266889 16:89068058-89068080 GCTGGAGGCTGGACTTCAGCAGG + Intergenic
1142289251 16:89185249-89185271 GCTCGGGGCTGCCCTGCTGCAGG - Exonic
1142292934 16:89201116-89201138 GCCGGCGGCCGCCCCGGAGCAGG + Exonic
1142431386 16:90029869-90029891 GCTTCAGGCTGCCCAGTAGCTGG + Intronic
1143119218 17:4596819-4596841 GCTGGAGGGGCCCCCGCAGCAGG + Intronic
1145176747 17:20707337-20707359 GCTGCAGGCTGCCCCCCAGCTGG + Intergenic
1146355150 17:32127366-32127388 GCTGCAGGCTGCCCCCCTGCTGG - Intergenic
1147123826 17:38352286-38352308 CGTGGAGGCGGCCCCGGAGCCGG + Exonic
1147350057 17:39835327-39835349 GCTGGAGGCCGCCCTACAGTGGG - Intronic
1147536371 17:41325292-41325314 GCTGGAGCCTGGCCAGCAGGAGG - Intergenic
1147779906 17:42933860-42933882 GCTAGAGTCTGCACCCCAGCAGG - Intergenic
1148792043 17:50178591-50178613 GCTGCACGCTGCCCCGGAGCAGG + Intergenic
1151582962 17:74990583-74990605 GCTGGAGGCTCCCCAGGAGAGGG + Intronic
1151727389 17:75892811-75892833 CCTGGAGGTTACCCAGCAGCAGG - Exonic
1152212454 17:79009663-79009685 ACCGGAGCCAGCCCCGCAGCGGG - Exonic
1152566666 17:81103384-81103406 GCTGGAGGCTGCTCTTCACCAGG - Intronic
1152573985 17:81132268-81132290 GCTGGATGCTGGCCAGCACCCGG + Intronic
1152689724 17:81712473-81712495 GCAGCAGGCGGCCCCGCAGGAGG - Exonic
1152716960 17:81904871-81904893 CCTGGAGGCTGCCAGGCAGCAGG - Exonic
1152728309 17:81958428-81958450 TCTGGAGGCTGCCGGGCGGCAGG - Intronic
1152822008 17:82442210-82442232 GCTGGAGGCTGCCCTGCAGCTGG + Exonic
1152962782 18:89639-89661 GCTGTGGGCTGCTCTGCAGCTGG + Intergenic
1154036381 18:10806244-10806266 GCTGTAGGGTTCCCCGCAGGTGG + Intronic
1154061376 18:11063720-11063742 GGTGCAGGCTGCCCGGGAGCAGG + Intronic
1155053849 18:22169142-22169164 GCGGGAGGGTGCACCGCCGCTGG + Intergenic
1156447486 18:37248431-37248453 GCTGGAGGGTGCCCTGCAGGGGG + Intronic
1156447497 18:37248465-37248487 GCTGGAGGGTCCCCTGCAGGGGG + Intronic
1157063551 18:44321150-44321172 GCTGAAGGCCGCCCTGTAGCAGG - Intergenic
1157498282 18:48171678-48171700 CCTGGAGGCTGGCCCAGAGCAGG + Intronic
1157717103 18:49895434-49895456 GCTGGAAGCTGCCTGGTAGCAGG + Intronic
1157770441 18:50340441-50340463 GCTGGAGGCTGCCGCCCAGCCGG + Intergenic
1159455894 18:68659936-68659958 GCTGGAGTCTGCCTCACAGTGGG + Intergenic
1161355083 19:3814545-3814567 CCTGGGGGCTGCCTTGCAGCAGG - Intronic
1162373483 19:10292240-10292262 GCAGGAGGGTGCCAGGCAGCTGG + Exonic
1162557647 19:11397399-11397421 GCTGGAGGCTGCCCTGCCCTTGG - Intronic
1162739083 19:12763726-12763748 TCTGGAGGTGCCCCCGCAGCTGG + Exonic
1165384651 19:35503192-35503214 GCTGGAGGAGGCCCGGCAGGTGG - Intronic
1165786220 19:38463524-38463546 GCTGCAGGCAGCCCCTCACCGGG - Exonic
1166333285 19:42090858-42090880 GCTGGAGGCTTCTCCGCCCCTGG + Exonic
1167015085 19:46836024-46836046 ACTGGAAGATGCTCCGCAGCTGG + Intergenic
1167307414 19:48716985-48717007 GCTGGAGGCAGCCCTGCCCCCGG + Intronic
1167557967 19:50207334-50207356 GCAGGAGGGGGCCACGCAGCAGG + Intronic
1167853667 19:52220985-52221007 GCTGGTGGCTGCCTCGCGGATGG - Exonic
1168153896 19:54462875-54462897 GCTGGAGGCGGCCCAGGAGAGGG - Exonic
1168333904 19:55586052-55586074 GCTGGAGGCTGCACGGGAGAGGG - Intergenic
924969234 2:109067-109089 GCTGGAAGCTTTCCCACAGCTGG - Intergenic
925055142 2:851416-851438 GCTGGACGCTGCCCAGCATGAGG - Intergenic
927462827 2:23313699-23313721 GTTGGAGGCTGCCACGCTGCAGG + Intergenic
928904504 2:36355870-36355892 CCCGGAGGCTGCGCCGCTGCGGG + Intergenic
932134587 2:69217268-69217290 GCTGGACACTGGCCAGCAGCAGG - Intronic
932790992 2:74654404-74654426 GCTGTAGGCTGCCCGGGACCCGG - Exonic
934521637 2:95023759-95023781 GCTGGAGGATGCCCTGCCGAGGG + Intergenic
937232381 2:120405730-120405752 GGAGGAGGCTGCCCTCCAGCAGG + Intergenic
937319848 2:120954634-120954656 GAGGGAGGCTGGCCCTCAGCAGG - Intronic
937872270 2:126794377-126794399 CCAGGTGGCTGCTCCGCAGCAGG - Intergenic
937877605 2:126837199-126837221 GCTGGACGCTGCCACCCGGCTGG - Intergenic
939994741 2:148909311-148909333 CCTGGAGGCTTGCCAGCAGCGGG - Intronic
941264844 2:163348476-163348498 GCTGTTGGCTGCCGCGCCGCTGG + Intergenic
942558653 2:177198166-177198188 GCTGGAGGCGGCCCTGCAGCGGG + Intergenic
944763439 2:202840696-202840718 GCTGGAGGCTGCCCTGCAGCGGG - Intronic
946320874 2:218953755-218953777 GCTGGAGGCCGCCATGCAGCGGG - Intergenic
946335170 2:219031118-219031140 GCTGGATGCTGCTCCTCTGCCGG + Exonic
946402949 2:219478016-219478038 GCTGGAGCCTGGCCAGCAGCCGG - Exonic
946483188 2:220075952-220075974 GCTGGGGGCTGCCCAGGGGCTGG - Intergenic
947972481 2:234335845-234335867 GCAGGACGCTGTCCAGCAGCAGG - Intergenic
948379101 2:237540765-237540787 GACGGAGGCTGACCAGCAGCAGG - Intronic
948403759 2:237702587-237702609 GCTGGAAGGTGGCCCGCTGCTGG - Intronic
948436090 2:237955689-237955711 GCTGGGCACTGCCCCGCTGCCGG + Intergenic
948626675 2:239273631-239273653 GCTGGAGCCTGCGCCGGACCGGG - Intronic
948673606 2:239584305-239584327 GCTGGAAGCTGCTGCACAGCGGG + Exonic
949060707 2:241955436-241955458 GGAGGAGGCTGCCCTGCTGCAGG + Intergenic
1168803889 20:661911-661933 ACTGGAGGCACCCCTGCAGCAGG - Exonic
1168890858 20:1294707-1294729 TCAGGAGGCAGCCCCGCCGCTGG + Intronic
1170895064 20:20405429-20405451 CCTGGAGGCTGCCACTGAGCAGG - Intronic
1171225145 20:23436420-23436442 TTTGGAGGGTGCCCAGCAGCAGG + Intergenic
1171810156 20:29740976-29740998 CCTGGTGGCTGCCCGGCAACCGG - Intergenic
1171865227 20:30484391-30484413 CCTGGAGGCGGCCCAGCAACTGG - Intergenic
1172118471 20:32584679-32584701 GCGGGCAGCGGCCCCGCAGCCGG - Intronic
1172447437 20:35000593-35000615 GCTGCGGGCTGCCCTGGAGCAGG + Exonic
1172844282 20:37920516-37920538 GCTGGAGGCTCCCCCTGAGATGG - Intronic
1174035727 20:47667283-47667305 GCTGGAGGCTGCCCACCAGGTGG + Intronic
1174380740 20:50153856-50153878 GCCGGAGGCTGGGACGCAGCTGG + Intergenic
1174582637 20:51583192-51583214 GCTGGGGACAGCCCCGAAGCAGG + Intergenic
1175890231 20:62312747-62312769 GCTTGCGGCTGCCCCCCAGCAGG + Exonic
1176177830 20:63737064-63737086 GCTGGAGGCTGGTCAGCAGGAGG - Intronic
1177638406 21:23815547-23815569 GCTGCATGCTGGCCAGCAGCAGG + Intergenic
1179008090 21:37531838-37531860 GCTGGAGGCTGTCCAGGAGTGGG - Intergenic
1179541186 21:42084116-42084138 CCTGGGGCCTGCCCCGCAGAGGG + Exonic
1179659707 21:42866393-42866415 GCTGCAGGATGCCCCTGAGCTGG - Intronic
1181636280 22:24176310-24176332 CCAGGAGGCTGCCTCACAGCTGG + Intronic
1181763168 22:25072027-25072049 GCTGGAGGATGCCTAGGAGCTGG + Intronic
1182271182 22:29154535-29154557 GCTGGGGGCTCTGCCGCAGCGGG - Intronic
1182302251 22:29343509-29343531 GCAGGAGGCAGCCCAGCATCTGG + Intronic
1182355579 22:29721028-29721050 GACGGGGGCGGCCCCGCAGCGGG - Intronic
1182511371 22:30822606-30822628 ATTGGAGGCTGCCCCGCCGCGGG + Intronic
1182622166 22:31624147-31624169 GCTGAGAGGTGCCCCGCAGCTGG - Intronic
1183231919 22:36587845-36587867 GCTGGGGACTGCCACGCAGGAGG + Intronic
1183458607 22:37936225-37936247 GCAGGAGGCTCCCCTGAAGCTGG - Intronic
1183669794 22:39265774-39265796 GATGGAGGCTGCCTCGGAGCAGG - Intergenic
1183741677 22:39672252-39672274 GCTGGAGGCTGTGCTGAAGCTGG + Exonic
1183977300 22:41519984-41520006 GCTGGAGGGAGCCCGGGAGCGGG + Intronic
1184264326 22:43339000-43339022 GCTGGAGGCTCAGCCCCAGCTGG + Intronic
1184523634 22:45009367-45009389 GCTGGAGCCTGCCCGGGGGCGGG - Intronic
1184528621 22:45040436-45040458 CCTGGAGGATGCCCTGTAGCCGG - Intergenic
1184996143 22:48209112-48209134 GCTGCAGCCTCCCCTGCAGCTGG - Intergenic
952611539 3:35216067-35216089 GCTGGAAGCCGCCCTGCAGCGGG - Intergenic
952900937 3:38111446-38111468 GCTGGCGGGTGGCCCGCAGCTGG + Intronic
953571531 3:44075590-44075612 GCTGCAGGCTGCCCTACAGCTGG + Intergenic
953930171 3:47002009-47002031 GCTGGAGGCTGCACTGGGGCGGG + Exonic
953949474 3:47177582-47177604 GCTGTAACCTGCCCTGCAGCTGG - Intergenic
955485597 3:59431606-59431628 GCTGCAGGGTGCCCTGCAGACGG - Intergenic
955839474 3:63096737-63096759 GCTGGAGGCCGCCCTGCAGCGGG - Intergenic
960947780 3:122978668-122978690 CCTGGAGGCTGCCCAGCGGAGGG - Intronic
961554461 3:127688652-127688674 GCTGGAGGATGCCCAGCAGCAGG + Intergenic
961656156 3:128443137-128443159 GCTGGAGGCTGTCCTGGAGGTGG + Intergenic
961665193 3:128489943-128489965 GCGGGAGGCAGACCAGCAGCTGG + Intronic
961810526 3:129519209-129519231 GATGGAGGCTGCCCTCCTGCAGG - Intronic
961813012 3:129532529-129532551 GCAGGCCGCTGCCCAGCAGCAGG + Exonic
961894541 3:130156403-130156425 ACTGTAGGCAGCCCCGCAGATGG + Intergenic
962712809 3:138101846-138101868 GCTGGAGGGCGCCCTGCAGCGGG - Intronic
965605784 3:170496496-170496518 GCTGGAGGCCGCCCTGCAGCGGG + Intronic
968048719 3:195638874-195638896 TCCTGGGGCTGCCCCGCAGCAGG - Intergenic
968093209 3:195910372-195910394 CCTGCAGGCTGCCCCGCCGCTGG - Intronic
968098686 3:195950750-195950772 TCCTGGGGCTGCCCCGCAGCAGG + Intergenic
968213403 3:196868037-196868059 CCTGGCAGCTGCCCCGCCGCCGG - Exonic
968305899 3:197651050-197651072 TCCTGGGGCTGCCCCGCAGCAGG + Intergenic
968548327 4:1209949-1209971 CCTGGAGGCTCCCACTCAGCTGG - Intergenic
968597426 4:1492630-1492652 CCAGGAGGCTGCCCAGCTGCTGG + Intergenic
968618774 4:1594184-1594206 GCTGGAGGCGGGGCCGCTGCTGG - Intergenic
969578946 4:8052703-8052725 GCTGCAGGATGCCCAGCATCTGG - Intronic
969605727 4:8201408-8201430 GCTGGAGGCTGGCCTGGGGCTGG + Intronic
973588895 4:52420488-52420510 CCTGGAGGCTGACCCTCACCTGG - Intergenic
977928666 4:102729087-102729109 GCTGGAGGCCGCCCTGCAGCAGG - Intronic
978761813 4:112361398-112361420 GCTGTAGGCTGCCAGGAAGCCGG + Intronic
982288756 4:153759802-153759824 GCTGGAGGCCCCCCCGCAGCAGG - Exonic
985278979 4:188268750-188268772 GCTGGAGGAGGCCCCGCCTCAGG + Intergenic
985505200 5:275361-275383 TCCTGGGGCTGCCCCGCAGCAGG - Intronic
985542850 5:494817-494839 CCTGGAGGCTGCCCAGCCGCTGG + Intronic
985629119 5:1005619-1005641 GCAGGGGGCTGCCCCACAGACGG + Intergenic
985974084 5:3401621-3401643 GCTGGTGGTTGCCCTGCAGTTGG - Intergenic
986125661 5:4880590-4880612 TCTGGAGTCAGCCCCGCAGGTGG - Intergenic
989180274 5:38569386-38569408 GCAGGAGGCTGCTCAGCAGGAGG + Intronic
990471910 5:56123236-56123258 CCTGGAGGCAGCCTGGCAGCTGG + Intronic
992089404 5:73303863-73303885 GCTGGAGGAGGCCCCGCAGGTGG - Intergenic
992431662 5:76716259-76716281 CCGGGAGGCTGCCCCGCCTCGGG - Exonic
992856981 5:80871899-80871921 GCTGTAGGCTGCCCCAAAGCGGG + Intronic
993453935 5:88105931-88105953 GCTGGAAGTTGTACCGCAGCAGG + Intergenic
994320797 5:98392442-98392464 GCTGGAGGCTGCCCCGCAGCCGG - Intergenic
996432904 5:123401257-123401279 GCTGGAGGCCGCCCTGCAGCGGG - Intronic
997364882 5:133319374-133319396 ACTGGAGGCTGCCCAGCATCGGG - Intronic
997577938 5:134997213-134997235 GCCGGAGGCTGCCCCTCGCCTGG + Intronic
999191218 5:149748864-149748886 GCTGGAGGCTGCTCTGCAGAAGG + Intronic
999449458 5:151667374-151667396 GCAGGATGCCGCCCTGCAGCTGG + Intronic
1001939646 5:175731426-175731448 GCTGGAGGTTGCACAGCAGGTGG - Intergenic
1002852316 6:1007429-1007451 GCTGGAGGGTGGCTCACAGCAGG + Intergenic
1003872644 6:10414318-10414340 TCTGGAGCGAGCCCCGCAGCTGG + Intronic
1003975924 6:11344581-11344603 GCTGGAGTTTGCCCCGAAGGAGG - Intronic
1004320789 6:14630080-14630102 TCTGGACGCTGCTCCGCTGCAGG - Intergenic
1005315512 6:24599417-24599439 GCTGGAGGCCACCCTGCAGTGGG + Intronic
1006300532 6:33191620-33191642 CCTCGATGCTGCCACGCAGCTGG - Intronic
1013287544 6:108693979-108694001 GCTGCAGGCTGGCCCAGAGCTGG - Intergenic
1014001635 6:116371339-116371361 CCTCGAGGCTGCTCCGCCGCCGG - Intronic
1015539185 6:134297337-134297359 GCTGGAGGCCGCCCTGCAGCGGG - Intronic
1018317268 6:162569341-162569363 GCTGGAGGCTGCCCTGCAACAGG + Intronic
1018450409 6:163902062-163902084 GCTGGGGGCTGCCACGCACCGGG + Intergenic
1018903309 6:168061864-168061886 GCTGGTGGCTGGCGCGCAGCAGG + Exonic
1019403239 7:868409-868431 GCTGCAGGCTGCACCGTGGCCGG + Intronic
1019571566 7:1715311-1715333 GCTGGGGGATGCCCCACAGTGGG - Intronic
1022164021 7:27740299-27740321 GCTGGAGGCCGCCCCGCACAAGG - Intronic
1022810472 7:33863145-33863167 TCTGGAGGCTGCACTGCACCAGG - Intergenic
1023851739 7:44153878-44153900 TCTGGAGGGTGCCAGGCAGCTGG + Intronic
1026024597 7:66734291-66734313 GCTCTAGGCTGCCCCAGAGCAGG - Intronic
1026151061 7:67788501-67788523 CCTGGAGGCCTCCCCGCACCTGG + Intergenic
1026889292 7:73972831-73972853 GCTCTAGGCTGCCCCGGAGCAGG - Intergenic
1028477154 7:91265063-91265085 GCTGGAGGCTCCGCTGCTGCTGG + Exonic
1028905884 7:96153565-96153587 GCTGCAGGCAGCACCACAGCGGG + Intronic
1032081859 7:128863123-128863145 GCTGGAGGCTGCCCGGACGGGGG + Intronic
1032097742 7:128947823-128947845 GCTGGAGGCCACCCAGGAGCAGG + Exonic
1033599377 7:142877684-142877706 GATGGAGGCTGCCCCGGAGCTGG - Exonic
1033606228 7:142930091-142930113 GATGGAGGCTGCCCCAGAGCTGG - Exonic
1033656995 7:143381320-143381342 GCTGGAGGCTGCTCCGGACCGGG + Exonic
1034781638 7:153887218-153887240 GCTGGAGGAGCCCCCGGAGCCGG + Intronic
1035239979 7:157523226-157523248 GCTGGAAGCTGTGCCGCAGCAGG + Intergenic
1035243830 7:157549830-157549852 GCAGGAGGCAGCTCCGAAGCGGG + Intronic
1035436712 7:158864971-158864993 GCTGGAGTCTGCCCAGCTGTCGG + Intronic
1036642198 8:10591623-10591645 GCTGGAGACTGCGCTGCGGCGGG + Intergenic
1037888025 8:22605133-22605155 GCAGGAGGGTGGCGCGCAGCCGG + Intronic
1039695430 8:39905509-39905531 GCTTGACTCTGCCCTGCAGCTGG - Intronic
1039883135 8:41639276-41639298 GCTGGAGTCTCCCCTGCACCTGG + Intergenic
1040997210 8:53413988-53414010 GCTCGAGGCTGCGCACCAGCAGG - Intergenic
1041244777 8:55879897-55879919 GCTGGAGGCTGCAGCGCGTCTGG - Exonic
1041781150 8:61579284-61579306 GCTGGAGGCTGCCCTGCAGCGGG + Intronic
1044838234 8:96315971-96315993 GCTGGAGGCTTCAGCACAGCGGG - Intronic
1048438972 8:134445816-134445838 GCCTGAGGCTGACCCGCAGCAGG + Intergenic
1049387091 8:142348529-142348551 GCCCCAGGCTGCCCCGAAGCTGG + Intronic
1049893018 9:88500-88522 GTTTGAGGATGCCCAGCAGCAGG - Intergenic
1053197227 9:36128508-36128530 TCAGGAAGCTGCCCCACAGCAGG + Intergenic
1053280683 9:36818285-36818307 GAGGGAGGCTGGCCCACAGCTGG + Intergenic
1055321644 9:75088394-75088416 GCTGGCAGCTTCGCCGCAGCAGG - Intergenic
1057151078 9:92796607-92796629 CCTGGAGGCTGCTCTGCAGGGGG - Intergenic
1057943659 9:99306224-99306246 GCTGGAGGCCGCCCTGCAGCGGG + Intergenic
1059269156 9:113061290-113061312 GCTGGAGGGTGCCAGGCAGCTGG - Intergenic
1059270291 9:113066739-113066761 GCTGGAGGGTGCCAGGCAGCTGG - Intergenic
1059271427 9:113072189-113072211 GCTGGAGGGTGCCAGGCAGCTGG - Intergenic
1059272558 9:113077633-113077655 GCTGGAGGGTGCCAGGCAGCTGG - Intergenic
1059273693 9:113083075-113083097 GCTGGAGGGTGCCAGGCAGCTGG - Intergenic
1059274828 9:113088521-113088543 GCTGGAGGGTGCCAGGCAGCTGG - Intergenic
1060952332 9:127612217-127612239 GAGCGAGGCTGCCCCGCCGCCGG - Intergenic
1061026891 9:128055539-128055561 CCTGGAGGCTACCCAGGAGCTGG + Intergenic
1061589860 9:131591333-131591355 GGTGGTGGCTGCCCAGCAGATGG + Intronic
1061617157 9:131787787-131787809 CCTGGAGGCTGCCCGGGCGCAGG + Intergenic
1061713255 9:132502126-132502148 GCAGGATGCTGCCACGCAGATGG - Intronic
1062051088 9:134447465-134447487 CCTGGAGGAAGCCCCACAGCTGG - Intergenic
1062052895 9:134456693-134456715 GCTGGAGCATGGCCGGCAGCTGG - Intergenic
1062130901 9:134892533-134892555 GCTGGAGCCTGGCCCACAGCAGG - Intergenic
1062165416 9:135105108-135105130 GCTGGAGGCTTCCTGGCAGTGGG - Intronic
1062222190 9:135422685-135422707 CCTGGAGGCTGCCTGGGAGCGGG + Intergenic
1062239303 9:135527088-135527110 TCTGGTGGCTGCCCCCAAGCTGG - Intergenic
1062457488 9:136646446-136646468 GCTGGAGGCCCCCACCCAGCGGG - Intergenic
1062474308 9:136719816-136719838 GCAGGAGGCTGCCCTGCTCCTGG - Intronic
1062483344 9:136762543-136762565 GCTGGAGGCTTCCGGGCTGCAGG - Intronic
1062513731 9:136921784-136921806 GGTGGTGGCTGCCCAGCTGCAGG + Intronic
1062735357 9:138134479-138134501 GCTGTGGGCTGCTCTGCAGCTGG - Intergenic
1187053118 X:15713866-15713888 GCTAGTGGCTGCCTCGTAGCTGG - Intronic
1189893776 X:45632652-45632674 GCTGGAGGCCGTTCTGCAGCGGG - Intergenic
1191220772 X:57985746-57985768 GCTGGAGGCTGCCCTGCAGCGGG + Intergenic
1194088440 X:89557342-89557364 GCTAGATTCTGCCCTGCAGCTGG - Intergenic
1196400532 X:115311798-115311820 GCTGTACGCGGCCCCACAGCTGG - Intergenic
1198619204 X:138488025-138488047 GCTGGAGGCAGCCCCGCAGGGGG - Intergenic
1199215044 X:145253286-145253308 GCTGGTGGCTGCCACTCAACAGG - Intronic
1199927275 X:152480637-152480659 GCTGGAGGCCACCCTGCAGCGGG + Intergenic
1200224746 X:154411404-154411426 GCAGGAGGCTGCCAGGAAGCGGG + Intronic
1200441116 Y:3213381-3213403 GCTAGATTCTGCCCTGCAGCTGG - Intergenic