ID: 994320802

View in Genome Browser
Species Human (GRCh38)
Location 5:98392461-98392483
Sequence CAGCTCGGACAGCTTGCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 11, 3: 24, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994320796_994320802 5 Left 994320796 5:98392433-98392455 CCTGCTGGGCCGGCTGCGGGGCA 0: 1
1: 0
2: 3
3: 37
4: 520
Right 994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG 0: 1
1: 0
2: 11
3: 24
4: 66
994320797_994320802 -4 Left 994320797 5:98392442-98392464 CCGGCTGCGGGGCAGCCTCCAGC 0: 1
1: 5
2: 22
3: 71
4: 294
Right 994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG 0: 1
1: 0
2: 11
3: 24
4: 66
994320789_994320802 19 Left 994320789 5:98392419-98392441 CCGCGCTATGTCCTCCTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 156
Right 994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG 0: 1
1: 0
2: 11
3: 24
4: 66
994320793_994320802 8 Left 994320793 5:98392430-98392452 CCTCCTGCTGGGCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 26
4: 340
Right 994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG 0: 1
1: 0
2: 11
3: 24
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994320802 Original CRISPR CAGCTCGGACAGCTTGCGGT TGG Intergenic
903646201 1:24897691-24897713 CAGCCCCCACAGCTTGAGGTTGG - Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
921162115 1:212480420-212480442 CAGCTCAGAGAACTTCCGGTTGG + Intergenic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1072209381 10:93232573-93232595 CAGCTCGGTCAGTTTGAGGCAGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1085319784 11:75566891-75566913 GACCTCGGGCAGCTTGCCGTCGG - Exonic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG + Intronic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100244144 12:92739520-92739542 AAGCTTGGACAGCTTACAGTGGG - Intronic
1108463031 13:50686417-50686439 CAGCTTGAACACCTTGAGGTTGG + Intronic
1113897728 13:113776494-113776516 CAGCTCGGACAGCAGCAGGTGGG - Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1120864602 14:89284984-89285006 CAGGTCGGACAGCCTGAGGGTGG + Intronic
1120896190 14:89534563-89534585 CAGCTAGGGCAGTTTGCCGTAGG - Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1125874771 15:43134018-43134040 CAGATCGGGCACCGTGCGGTGGG + Intronic
1125930155 15:43594314-43594336 CAGCTCGTACAGGTTCCGGTCGG - Exonic
1125943323 15:43694146-43694168 CAGCTCGTACAGGTTCCGGTCGG - Exonic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG + Exonic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1134097105 16:11425160-11425182 CGGCACGGACAGCTTGCGGGTGG - Exonic
1136389164 16:29951464-29951486 CAGCTCGGACACAGTGGGGTAGG - Intronic
1137531439 16:49281235-49281257 CATCTCGGACGGCTCGTGGTTGG + Exonic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1139604646 16:68009470-68009492 CAGCTGGGACAGCTGGTGCTGGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1142183112 16:88681290-88681312 CAGCCCGGCCAGCGTGTGGTAGG + Exonic
1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1152298397 17:79481631-79481653 TGGCTCGGGGAGCTTGCGGTTGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1159770408 18:72541837-72541859 CATCTCGGACGGCTCGTGGTTGG + Exonic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
939806112 2:146777421-146777443 CAGCTCTAACAGCTTGCATTTGG - Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
1171416426 20:24984127-24984149 GAGGTCGGCCAGCTTGCAGTGGG - Intronic
1173383659 20:42568690-42568712 CAGCTCAGACAGCTCTCTGTAGG - Intronic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1175543241 20:59761381-59761403 CAGCTTGGGCAGCTGGCTGTGGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999144026 5:149380980-149381002 GGGCTGGGACAGCCTGCGGTGGG - Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1012661850 6:101908094-101908116 CAGCTCGGACAGAATGATGTAGG - Intronic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1020408886 7:7868132-7868154 CTGCCTGGACAGCTTACGGTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG + Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1030499335 7:110339898-110339920 CATCTTGGACAGCTTTCGGGAGG - Intergenic
1031992320 7:128206457-128206479 CAGCGCGGAAAGCTGGCTGTGGG + Intergenic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1035259455 7:157652448-157652470 CAGCTCTGACACCTTGCTGATGG + Intronic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1049746928 8:144266933-144266955 AATCTTGGAGAGCTTGCGGTCGG - Exonic
1053409202 9:37904628-37904650 AAGCTCAGACAGCTTGCGGGGGG + Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1192201772 X:69070965-69070987 CAGCTCTGTCAGCATCCGGTGGG - Intergenic
1192846025 X:74907918-74907940 CAGCTGAGACAGCCTGAGGTGGG - Intronic