ID: 994326625

View in Genome Browser
Species Human (GRCh38)
Location 5:98455145-98455167
Sequence AAACTGCAACAGATGTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994326622_994326625 30 Left 994326622 5:98455092-98455114 CCTGAATCATTACTAAGTGATGC No data
Right 994326625 5:98455145-98455167 AAACTGCAACAGATGTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994326625 Original CRISPR AAACTGCAACAGATGTGAAG TGG Intergenic
No off target data available for this crispr