ID: 994332779

View in Genome Browser
Species Human (GRCh38)
Location 5:98526844-98526866
Sequence AGGGGCTGTGGGCAGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994332779_994332788 7 Left 994332779 5:98526844-98526866 CCCAGCTTCTGCCCACAGCCCCT No data
Right 994332788 5:98526874-98526896 TACGTTTAACACAGCAGCTAGGG No data
994332779_994332787 6 Left 994332779 5:98526844-98526866 CCCAGCTTCTGCCCACAGCCCCT No data
Right 994332787 5:98526873-98526895 CTACGTTTAACACAGCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994332779 Original CRISPR AGGGGCTGTGGGCAGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr