ID: 994333824

View in Genome Browser
Species Human (GRCh38)
Location 5:98540415-98540437
Sequence GTAGAGCAGCTGTGCTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994333817_994333824 13 Left 994333817 5:98540379-98540401 CCAGCCTCGGTAACATAGCAAGA No data
Right 994333824 5:98540415-98540437 GTAGAGCAGCTGTGCTCTGTTGG No data
994333821_994333824 -10 Left 994333821 5:98540402-98540424 CCCCTGGCTTTTGGTAGAGCAGC No data
Right 994333824 5:98540415-98540437 GTAGAGCAGCTGTGCTCTGTTGG No data
994333818_994333824 9 Left 994333818 5:98540383-98540405 CCTCGGTAACATAGCAAGACCCC No data
Right 994333824 5:98540415-98540437 GTAGAGCAGCTGTGCTCTGTTGG No data
994333815_994333824 27 Left 994333815 5:98540365-98540387 CCAGGAGTTCAAGACCAGCCTCG 0: 102
1: 19651
2: 40702
3: 60690
4: 52545
Right 994333824 5:98540415-98540437 GTAGAGCAGCTGTGCTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994333824 Original CRISPR GTAGAGCAGCTGTGCTCTGT TGG Intergenic
No off target data available for this crispr