ID: 994335326

View in Genome Browser
Species Human (GRCh38)
Location 5:98558257-98558279
Sequence CTGTATAGGAATGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994335322_994335326 -1 Left 994335322 5:98558235-98558257 CCTTAGAGATGTACAGCTAAAGC No data
Right 994335326 5:98558257-98558279 CTGTATAGGAATGAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994335326 Original CRISPR CTGTATAGGAATGAAGAGGA GGG Intergenic
No off target data available for this crispr