ID: 994336980

View in Genome Browser
Species Human (GRCh38)
Location 5:98578510-98578532
Sequence ACATAGATAATAAAAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994336980_994336986 11 Left 994336980 5:98578510-98578532 CCTTCCCTTTTTATTATCTATGT No data
Right 994336986 5:98578544-98578566 CTTTTTCACCCTGGTAAAAGAGG No data
994336980_994336984 2 Left 994336980 5:98578510-98578532 CCTTCCCTTTTTATTATCTATGT No data
Right 994336984 5:98578535-98578557 GGATTCCAACTTTTTCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994336980 Original CRISPR ACATAGATAATAAAAAGGGA AGG (reversed) Intergenic
No off target data available for this crispr