ID: 994336984

View in Genome Browser
Species Human (GRCh38)
Location 5:98578535-98578557
Sequence GGATTCCAACTTTTTCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994336979_994336984 9 Left 994336979 5:98578503-98578525 CCTATATCCTTCCCTTTTTATTA No data
Right 994336984 5:98578535-98578557 GGATTCCAACTTTTTCACCCTGG No data
994336980_994336984 2 Left 994336980 5:98578510-98578532 CCTTCCCTTTTTATTATCTATGT No data
Right 994336984 5:98578535-98578557 GGATTCCAACTTTTTCACCCTGG No data
994336981_994336984 -2 Left 994336981 5:98578514-98578536 CCCTTTTTATTATCTATGTATGG No data
Right 994336984 5:98578535-98578557 GGATTCCAACTTTTTCACCCTGG No data
994336983_994336984 -3 Left 994336983 5:98578515-98578537 CCTTTTTATTATCTATGTATGGA No data
Right 994336984 5:98578535-98578557 GGATTCCAACTTTTTCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994336984 Original CRISPR GGATTCCAACTTTTTCACCC TGG Intergenic
No off target data available for this crispr