ID: 994348670

View in Genome Browser
Species Human (GRCh38)
Location 5:98718857-98718879
Sequence CAGAATATAGGCATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994348665_994348670 5 Left 994348665 5:98718829-98718851 CCTAGAAGGAAACCTAGGCAATA 0: 105
1: 8657
2: 11191
3: 4879
4: 3084
Right 994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG No data
994348664_994348670 6 Left 994348664 5:98718828-98718850 CCCTAGAAGGAAACCTAGGCAAT 0: 100
1: 8381
2: 10598
3: 3935
4: 2053
Right 994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG No data
994348666_994348670 -7 Left 994348666 5:98718841-98718863 CCTAGGCAATACCATTCAGAATA No data
Right 994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG No data
994348662_994348670 15 Left 994348662 5:98718819-98718841 CCATAAAAACCCTAGAAGGAAAC 0: 123
1: 14034
2: 5920
3: 2253
4: 1799
Right 994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994348670 Original CRISPR CAGAATATAGGCATGGACAA AGG Intergenic
No off target data available for this crispr