ID: 994350290

View in Genome Browser
Species Human (GRCh38)
Location 5:98737692-98737714
Sequence GAGCTGCCATGGGCTCCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994350290_994350300 17 Left 994350290 5:98737692-98737714 CCGGGTGGAGCCCATGGCAGCTC No data
Right 994350300 5:98737732-98737754 TCTGTAGACTCCACCTCTTGGGG 0: 17
1: 1196
2: 3725
3: 1230
4: 871
994350290_994350302 22 Left 994350290 5:98737692-98737714 CCGGGTGGAGCCCATGGCAGCTC No data
Right 994350302 5:98737737-98737759 AGACTCCACCTCTTGGGGCAGGG 0: 18
1: 1158
2: 4042
3: 1424
4: 1215
994350290_994350299 16 Left 994350290 5:98737692-98737714 CCGGGTGGAGCCCATGGCAGCTC No data
Right 994350299 5:98737731-98737753 CTCTGTAGACTCCACCTCTTGGG 0: 17
1: 1266
2: 3899
3: 1989
4: 9928
994350290_994350305 30 Left 994350290 5:98737692-98737714 CCGGGTGGAGCCCATGGCAGCTC No data
Right 994350305 5:98737745-98737767 CCTCTTGGGGCAGGGCATAGTGG No data
994350290_994350301 21 Left 994350290 5:98737692-98737714 CCGGGTGGAGCCCATGGCAGCTC No data
Right 994350301 5:98737736-98737758 TAGACTCCACCTCTTGGGGCAGG 0: 16
1: 1173
2: 4045
3: 1458
4: 1221
994350290_994350298 15 Left 994350290 5:98737692-98737714 CCGGGTGGAGCCCATGGCAGCTC No data
Right 994350298 5:98737730-98737752 CCTCTGTAGACTCCACCTCTTGG 0: 1150
1: 3748
2: 1173
3: 410
4: 1550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994350290 Original CRISPR GAGCTGCCATGGGCTCCACC CGG (reversed) Intergenic
No off target data available for this crispr