ID: 994353333

View in Genome Browser
Species Human (GRCh38)
Location 5:98770101-98770123
Sequence CAGGGGTTTCGGGTCTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994353322_994353333 29 Left 994353322 5:98770049-98770071 CCCATGAAATTCGTGGGAACTTG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 994353333 5:98770101-98770123 CAGGGGTTTCGGGTCTGCCCGGG 0: 1
1: 0
2: 1
3: 16
4: 178
994353323_994353333 28 Left 994353323 5:98770050-98770072 CCATGAAATTCGTGGGAACTTGT 0: 1
1: 0
2: 1
3: 18
4: 206
Right 994353333 5:98770101-98770123 CAGGGGTTTCGGGTCTGCCCGGG 0: 1
1: 0
2: 1
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994353333 Original CRISPR CAGGGGTTTCGGGTCTGCCC GGG Intronic
900216783 1:1486029-1486051 CAGGGGCTGCGGGAATGCCCGGG - Intronic
902367856 1:15989253-15989275 CAGGGGTGTGGGGTGTGCCTGGG + Intergenic
903583589 1:24391025-24391047 CAGGAGTTTCAGATCAGCCCAGG - Intronic
904066742 1:27758056-27758078 TAGGGGTTTCTGATCTCCCCTGG + Intronic
904369886 1:30041824-30041846 CAGGGGTTTCCCATCTGACCTGG - Intergenic
906580818 1:46934112-46934134 CAGGGGCCCCTGGTCTGCCCAGG - Intronic
906602906 1:47144782-47144804 CAGGGGCCCCTGGTCTGCCCAGG + Intronic
908628517 1:66074975-66074997 GAGGGTTTTTGGCTCTGCCCAGG + Intronic
910828278 1:91432613-91432635 CAGGAGTTTGGGGTCAGCCTGGG - Intergenic
915680100 1:157573113-157573135 CAAGGCTTTGAGGTCTGCCCTGG - Intergenic
1064031749 10:11887224-11887246 CACTGGTTTCGGGTCTGGTCAGG - Intergenic
1066539288 10:36427823-36427845 CAGGAGTTCCGGATCTGCCTGGG + Intergenic
1067177926 10:43963156-43963178 CAGGGCTTAAGGGTCTGCCGTGG - Intergenic
1072690198 10:97567812-97567834 CAGGGTTTCAGGGTCTGGCCTGG + Intronic
1072898551 10:99387933-99387955 TAGGGGTCTGGGGTGTGCCCCGG - Exonic
1073025516 10:100484491-100484513 CAAGGGTTTGGGATCTGACCTGG - Intergenic
1076437117 10:130454006-130454028 CACAGCTTTCGGGGCTGCCCGGG - Intergenic
1076556084 10:131322294-131322316 GAGGGGTTTCTGGACAGCCCCGG - Intergenic
1076866788 10:133170371-133170393 CTGGGGTCTGGGGTCTGGCCTGG + Intronic
1077544169 11:3161934-3161956 CAGGGGTCTGGCGTCAGCCCCGG - Intronic
1078941723 11:16013819-16013841 CAGGGATTTCTGGGCTGCCTGGG + Intronic
1079121535 11:17688567-17688589 CAGGGATTTGGGATGTGCCCCGG - Intergenic
1080509047 11:32948534-32948556 CAGGAGTATCGGGTGAGCCCAGG + Intronic
1084615297 11:70231817-70231839 CGGGGGTTGCAGGTCTGTCCAGG - Intergenic
1085451407 11:76636251-76636273 CAGGGGTTTTGAATCTGCCCTGG + Intergenic
1089000603 11:115048942-115048964 CAGGGTTTTCGCTACTGCCCAGG - Intergenic
1089563397 11:119357157-119357179 CAGGGGCTCCGGCCCTGCCCTGG + Intronic
1093047038 12:14458612-14458634 CAGGAGTTCCGGGCCTGCCGGGG + Intronic
1096076442 12:48808682-48808704 CAGGGGTTTGAGACCTGCCCAGG + Intergenic
1096496352 12:52041592-52041614 CAGGGGTGTAGGGTGTGGCCAGG - Intronic
1097267742 12:57755599-57755621 CCGGGGTTGCGGCTCGGCCCGGG - Exonic
1097350790 12:58546540-58546562 CAGGGTTTTAGGCTATGCCCTGG + Intronic
1100264534 12:92962752-92962774 CAGGGGTTTCTGATCAGCCTGGG - Intergenic
1102518644 12:113465861-113465883 CCGGGGTTGGGGGTCTGTCCAGG + Intronic
1103714308 12:122935121-122935143 CAGGAGGTTCGAGTCTGGCCAGG + Intronic
1104636156 12:130438846-130438868 CAGGGGTCTCAGGCCTGGCCAGG + Intronic
1105523079 13:21149093-21149115 CAGTGCTTTAGTGTCTGCCCTGG + Intergenic
1108043238 13:46358761-46358783 CAGGAGTTTGGGGTCAGCCTGGG - Intronic
1112467602 13:99657957-99657979 CACGGGCTTGGGTTCTGCCCCGG - Intronic
1113481955 13:110627850-110627872 CAGAGGTTTGGGGTCAGGCCTGG + Intronic
1113855938 13:113445536-113445558 CTGGGCTTGCGGGTCAGCCCCGG + Intronic
1116831089 14:49720326-49720348 CAGGAGTTTCAGGTCTGCCTGGG - Intronic
1117677649 14:58170907-58170929 CAGGGGTTTGGTGCCTTCCCTGG - Intronic
1120911836 14:89673763-89673785 CAGGAGTTCAGGGTCAGCCCAGG + Intergenic
1122690962 14:103532021-103532043 CAGGGGCTGGGGCTCTGCCCTGG - Intronic
1122694777 14:103547266-103547288 GCGGGCTATCGGGTCTGCCCTGG + Intergenic
1124137660 15:27048936-27048958 CAGGTGTTTGGGGGCTACCCTGG + Intronic
1129194513 15:73956012-73956034 CAAGGGTTTCAGGCCAGCCCTGG - Intergenic
1129669209 15:77597830-77597852 CAGGGGTTTGAAGTCTGCTCAGG + Intergenic
1130461362 15:84159968-84159990 CACTGGTTTCGGTTCTGTCCTGG + Intergenic
1130935648 15:88468046-88468068 CAGGGGTTGCGGGTCTCCAGAGG - Intronic
1132353168 15:101153138-101153160 CAGGGCTTCCGAGGCTGCCCTGG - Intergenic
1132548456 16:544301-544323 CACAGGTTGCGGGGCTGCCCCGG + Intronic
1132589250 16:719301-719323 CAGGGGCTTCATGCCTGCCCTGG + Exonic
1132658349 16:1050623-1050645 CAGGCGTTTCGGGGCCGACCCGG + Intergenic
1132698384 16:1211946-1211968 CAGGGGTTGTGGTTCTGCACAGG - Exonic
1132729023 16:1351641-1351663 CAGGGTTTGAGGGCCTGCCCGGG - Intronic
1132978075 16:2720381-2720403 CTGGGGTGAGGGGTCTGCCCTGG - Intronic
1138596413 16:58031505-58031527 CAGGAGTTTCGGGCCTGGCTGGG - Intronic
1139096372 16:63709330-63709352 TAGGGGTTGTAGGTCTGCCCTGG - Intergenic
1139316929 16:66080533-66080555 CAGGAGTTTCGGATCAGCCTGGG + Intergenic
1140409396 16:74732984-74733006 CAGTGCTTGCGGGTCTACCCAGG - Intronic
1141111334 16:81273271-81273293 CAGGGGTTTAGGGCCGGCCACGG - Intronic
1142018535 16:87765698-87765720 CCGGGGTTACGGGTCGGCCGTGG - Intronic
1142373307 16:89694797-89694819 CGGGGGCTGCGGGTCTGCCCAGG - Intronic
1143660155 17:8319565-8319587 CAGGTGTTTGGGGGCAGCCCTGG - Exonic
1143759171 17:9088620-9088642 CCAGGCTTCCGGGTCTGCCCTGG - Intronic
1144299685 17:13911608-13911630 CAGGGGTTTCAGGCCAGCCTAGG + Intergenic
1144464015 17:15482126-15482148 CAGGGGTTGGGGGTCTGCCCTGG - Intronic
1144964459 17:19067364-19067386 CAGGGGTTTAGGAGCTGCCTGGG + Intergenic
1144968681 17:19093687-19093709 CAGGAGTCTCGGGTCTTCTCCGG + Exonic
1144983508 17:19184810-19184832 CAGGGGTTTAGGAGCTGCCTGGG - Intergenic
1144984717 17:19193429-19193451 CAGGGGTTTAGGAGCTGCCTGGG + Intergenic
1145166126 17:20614493-20614515 GTGGGGTTTCGGCTCTGCCTGGG + Intergenic
1147061724 17:37885162-37885184 CAGGGGTTCCAGGGCAGCCCGGG + Intergenic
1147968982 17:44209616-44209638 CTGGGGGTTGGAGTCTGCCCTGG - Intronic
1148177274 17:45577775-45577797 CAGGAGTTTCAGGTCAGCCTGGG + Intergenic
1151436052 17:74098143-74098165 CTGGGGTCTAGGGTCAGCCCTGG + Intergenic
1152303384 17:79508129-79508151 CAGGGATTTCCTTTCTGCCCCGG - Intronic
1152655959 17:81519334-81519356 CCGGGGCTTCGGGTGGGCCCAGG + Intronic
1152822879 17:82446079-82446101 CAGGGGTTTGGGTTCTGACTGGG - Intronic
1152931769 17:83113632-83113654 CAGGCCTTTCGGGTGAGCCCTGG - Intergenic
1156830390 18:41484501-41484523 CATGGGTTGTGGGTCTGCACAGG + Intergenic
1157513555 18:48295496-48295518 CAGGCGTTCTGGGTCTGCCGGGG - Intronic
1158501986 18:58010714-58010736 CAGGGGTTTGGGGTAGGGCCAGG - Intergenic
1160897295 19:1408584-1408606 CAGGGGGCTCGGGTCAGCCGGGG + Intronic
1162472034 19:10878048-10878070 CAGGGGTTTGGGGCCAGCCTGGG - Intronic
1162530983 19:11236421-11236443 CAAGGGGTTCGGGGCTGGCCAGG + Exonic
1162842392 19:13365876-13365898 CAGGGGTTTCAGGCCAGCCTGGG - Intronic
1163365588 19:16874261-16874283 CAGGGTTTGCTGGTCTGGCCTGG + Intronic
1164980122 19:32607536-32607558 CAGGGGTTTGGTGGCTACCCTGG - Intronic
1165017345 19:32890720-32890742 CAGGGGTTGAGGGGCTCCCCTGG - Intronic
1165585982 19:36916141-36916163 CAGCCGTTTCGGGTGGGCCCAGG - Intronic
1166853022 19:45769310-45769332 CAGGGGGGGCGGGTCTGGCCGGG + Intergenic
1167042660 19:47031930-47031952 CAGGGGTTGCTGGGCTGTCCTGG + Intronic
1168126589 19:54286727-54286749 CGGGGGTTCCAGCTCTGCCCAGG + Intergenic
1168175301 19:54624136-54624158 CGGGGGTTCCAGCTCTGCCCAGG - Intronic
927495654 2:23549990-23550012 CTGGGGTTCTGGGTCTACCCTGG + Intronic
928261017 2:29766816-29766838 CATGGGTTTCAGGTCTGTCAGGG - Intronic
930058919 2:47272607-47272629 AAGGGGTTCCTGGTCGGCCCAGG - Intergenic
931436745 2:62254196-62254218 CAGGGGTTCTGGGAATGCCCAGG + Intergenic
932773651 2:74514878-74514900 CTGGGGTTTCGGGGCCGCTCAGG - Exonic
934130400 2:88942667-88942689 CAGGGCTTTAGGGTGTGTCCTGG - Intergenic
934764809 2:96874730-96874752 CCGGGGCTTCGGGGGTGCCCGGG + Intergenic
935262135 2:101364718-101364740 CAGGTGGCTCAGGTCTGCCCAGG - Intronic
937626523 2:124050253-124050275 CAGGAGTTTGAGGTCAGCCCCGG + Intronic
937927826 2:127181747-127181769 GAGGGTTTTAGGTTCTGCCCTGG + Intergenic
940856229 2:158730619-158730641 CAGGGGTTTGGGGTTGCCCCTGG + Intergenic
948871235 2:240799285-240799307 CAGGAGTTCAGCGTCTGCCCTGG - Intronic
949027915 2:241774916-241774938 CAGGGGTTAGGGCTCTGCCATGG + Intergenic
949065178 2:241985892-241985914 CCGGGCTTTCGTCTCTGCCCAGG + Intergenic
1171087193 20:22248612-22248634 CAGGTATTTCTGGACTGCCCTGG - Intergenic
1171426064 20:25049481-25049503 CAGGGGCTTCGAATCTGCCCTGG - Intronic
1174290614 20:49505870-49505892 CTGGGGTTTGGGGGCTTCCCTGG - Exonic
1174802373 20:53575133-53575155 CAGGGGTTTCAGACCAGCCCGGG + Intronic
1176384925 21:6134523-6134545 CAGGGGGTTCGGGGCTGGCCAGG + Intergenic
1178984441 21:37290888-37290910 CAGGGCTTACTTGTCTGCCCTGG - Intergenic
1179504308 21:41830817-41830839 CTGTGGTTTCGGCTCCGCCCAGG + Intronic
1179738547 21:43403729-43403751 CAGGGGGTTCGGGGCTGGCCAGG - Intergenic
1179951179 21:44709555-44709577 CTGGGGGTTCGGGTCTGCCACGG - Intronic
1180051084 21:45331233-45331255 GAGGTGGTTCGGGGCTGCCCTGG - Intergenic
1180798425 22:18619471-18619493 CAGCGGGTTAGGGTCTGGCCAGG - Intergenic
1180908451 22:19431821-19431843 CAGGGGCTTCGGGTCGGGCCCGG + Intronic
1181223293 22:21375794-21375816 CAGCGGGTTAGGGTCTGGCCAGG + Intergenic
1181255447 22:21559832-21559854 CAGCGGGTTAGGGTCTGGCCAGG - Intronic
1185033960 22:48461076-48461098 CAGAGGTTTCGGGAGTGCCCGGG - Intergenic
1185151376 22:49165434-49165456 CAGGGATTTCTGGTCAACCCAGG + Intergenic
950796147 3:15512040-15512062 CAGGGGTTTCGGGCCTGGCATGG - Intronic
952532809 3:34279627-34279649 CAGGGGTCTCTGGTCCGCCTTGG - Intergenic
957108716 3:75925182-75925204 CAGGAGTTTCAGATCAGCCCGGG + Intronic
961484224 3:127206335-127206357 ATGGAGTTTCGGTTCTGCCCAGG + Intergenic
962898575 3:139737330-139737352 GAGGGGTTTGGGGTCTGCCAAGG + Intergenic
963850156 3:150203011-150203033 CAGGGGTTTACTGTCTTCCCTGG - Intergenic
968761292 4:2443814-2443836 CTGGGGGTTCTGGCCTGCCCCGG - Intronic
968812615 4:2806750-2806772 CATGGGAGTCGGGACTGCCCGGG - Intronic
969471513 4:7392091-7392113 CAGGGGCTTCGTGGCTGCGCAGG + Intronic
969515332 4:7644639-7644661 GAGGTGCTTCGAGTCTGCCCTGG - Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
969686719 4:8679590-8679612 GAGGGGTGAGGGGTCTGCCCTGG - Intergenic
971318223 4:25584749-25584771 CAGGAGATTCTGGTCTTCCCAGG - Intergenic
979295415 4:119027196-119027218 CAGGAGATGCGGGACTGCCCCGG + Exonic
979968532 4:127106334-127106356 CAGAGGTTTCAGGTATCCCCAGG + Intergenic
980234737 4:130090624-130090646 CAGGGGTTCCGGGTGGGCACAGG + Intergenic
981215655 4:142163707-142163729 CAGGGGTTTCAGGCATCCCCTGG + Intronic
985643412 5:1074186-1074208 CGGGGGCCTCGGGTGTGCCCCGG - Intronic
988993441 5:36692979-36693001 CAGGGGTTGCTGGGCCGCCCCGG - Intergenic
994353333 5:98770101-98770123 CAGGGGTTTCGGGTCTGCCCGGG + Intronic
996063542 5:119057158-119057180 CAGGAGTTTCGAGACTGGCCTGG + Intronic
997282821 5:132659360-132659382 CAGGGGTTGTGGGCCTGCCCTGG - Intronic
998271852 5:140713738-140713760 CAGGAGTTTGGGATCTGCCTGGG - Intergenic
999673426 5:153976785-153976807 CAGGGGCTCCGGGTCTTTCCTGG - Intergenic
1000358277 5:160421984-160422006 CTGGGGTTGGGGGACTGCCCGGG + Exonic
1001038628 5:168316017-168316039 CCTGGGTTTGGGGTCAGCCCTGG - Intronic
1001772837 5:174308842-174308864 CAGGGGGTGTGGGTCTTCCCTGG + Intergenic
1001790140 5:174449269-174449291 CAGGAGTTTCAGATCAGCCCGGG + Intergenic
1001924865 5:175628657-175628679 CAGGGTTTCCGGGTCTGGCTGGG - Intergenic
1002039090 5:176497939-176497961 CAGGAGTTTGAGGTCAGCCCGGG + Intronic
1002817518 6:693822-693844 CAGGGGTTTGAGGGCTGCACTGG + Intergenic
1003538545 6:6997928-6997950 CAGGGGTTTGGGGCCAGCCTGGG - Intergenic
1004927402 6:20428915-20428937 CTGGTGTTTTGGCTCTGCCCTGG - Intronic
1005989053 6:30892069-30892091 CAGGAGCTGCGGGTCTGGCCAGG + Exonic
1007744287 6:44033968-44033990 CAGGAGTTTCAGGTCAGCCTGGG + Intergenic
1012827418 6:104163382-104163404 CAGTGTTTTTGGATCTGCCCTGG + Intergenic
1013633532 6:112007933-112007955 CAGGGGTCTCGGGACTGCTTGGG - Intergenic
1017484416 6:154889718-154889740 CAGGGGCTGCAGGTCTGCCCTGG + Intronic
1019028725 6:168992350-168992372 CAGGGGGTTGGGGGCTGCTCGGG - Intergenic
1019032389 6:169024396-169024418 CCGGCGTCTCGGGGCTGCCCGGG + Intergenic
1019135595 6:169905716-169905738 CCGGGGTGTGGGGTCTGCACTGG + Intergenic
1019356724 7:583990-584012 CTGGGGTTTCAGGTGTGCCCAGG - Intronic
1022299539 7:29090178-29090200 GAGGGGTTTTGGATTTGCCCAGG - Intronic
1022816330 7:33918047-33918069 CAGGAGTTTGAGGTCAGCCCTGG - Intronic
1023529720 7:41139690-41139712 CAGGGGCTTTGTGTATGCCCTGG + Intergenic
1024055432 7:45657406-45657428 CTGGGATTTGGGGACTGCCCTGG + Intronic
1024834594 7:53501400-53501422 CAGGGCTTTCAAGTGTGCCCTGG + Intergenic
1026096446 7:67350276-67350298 CAGGAGTTTCGGATCAGCCTAGG + Intergenic
1026672756 7:72404001-72404023 CATGGGTTGCAGGTCTGCCCTGG - Intronic
1032215205 7:129952426-129952448 CAGTGGTTCCGGGGGTGCCCTGG + Intronic
1033099195 7:138456252-138456274 CAGGAGTTTGAGGTCTGCCTTGG - Intergenic
1036025830 8:4907772-4907794 CAGGGGTTTCGGAGCAGCCTGGG - Intronic
1036613551 8:10371027-10371049 CAGGGGATTCGGATGTGCCTAGG - Intronic
1037806709 8:22061963-22061985 CAGGAGTTTGAGGTCTGCCTGGG - Intronic
1038163427 8:25061996-25062018 CAGGGGCTTCGTGCATGCCCAGG + Intergenic
1041167133 8:55101898-55101920 CGGGGGTTGGGGGACTGCCCTGG - Intergenic
1043693443 8:83187235-83187257 CAGGGTTTTCTTGTCTGCCTGGG - Intergenic
1049398945 8:142416277-142416299 AAGGGGATGCGGGTCTGTCCTGG + Intergenic
1049607151 8:143534969-143534991 CACGGCTCTTGGGTCTGCCCAGG + Intronic
1051658419 9:19404480-19404502 CAGGGGCTCTGAGTCTGCCCTGG - Intergenic
1054715030 9:68548408-68548430 CATGGGTTTCGCCTGTGCCCTGG + Intergenic
1055141475 9:72881788-72881810 CAGGGATTTCTGGGCTGCCAAGG + Intergenic
1057279508 9:93699749-93699771 CTGAGGTTTCAGTTCTGCCCTGG - Intergenic
1186349399 X:8727732-8727754 CAAGGCTTTGGGGTGTGCCCAGG - Intronic
1190055193 X:47177393-47177415 CAGTGGCTTCAGGTCTGCCCTGG + Intronic
1190058153 X:47194061-47194083 CAGGGGTTTCGGGGAGGCACTGG + Intronic
1195104776 X:101593503-101593525 CAGAGGTTTCAGGTCTCCCTGGG - Intergenic
1198699060 X:139376946-139376968 CAGGGGTTTGGGGGCTGCAGGGG + Intergenic
1200017780 X:153179477-153179499 CAGGGGTCTGGGGGCAGCCCAGG - Intronic