ID: 994353373

View in Genome Browser
Species Human (GRCh38)
Location 5:98770302-98770324
Sequence CCTTCTTGGGAGCGAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994353365_994353373 26 Left 994353365 5:98770253-98770275 CCTGGAAGAAAAGCCTAAATACA 0: 1
1: 0
2: 1
3: 27
4: 335
Right 994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG No data
994353367_994353373 13 Left 994353367 5:98770266-98770288 CCTAAATACATTAGCGAGCTGGT 0: 1
1: 0
2: 1
3: 0
4: 48
Right 994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994353373 Original CRISPR CCTTCTTGGGAGCGAGTGGC TGG Intronic
No off target data available for this crispr