ID: 994353898

View in Genome Browser
Species Human (GRCh38)
Location 5:98774119-98774141
Sequence GTTGAGCAGCGCCGCAGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994353890_994353898 7 Left 994353890 5:98774089-98774111 CCTTCCAGCGCCGCCGCTGCCGC 0: 1
1: 0
2: 7
3: 101
4: 764
Right 994353898 5:98774119-98774141 GTTGAGCAGCGCCGCAGCCCCGG 0: 1
1: 0
2: 1
3: 11
4: 121
994353891_994353898 3 Left 994353891 5:98774093-98774115 CCAGCGCCGCCGCTGCCGCCGCC 0: 1
1: 92
2: 1366
3: 2051
4: 4041
Right 994353898 5:98774119-98774141 GTTGAGCAGCGCCGCAGCCCCGG 0: 1
1: 0
2: 1
3: 11
4: 121
994353894_994353898 -6 Left 994353894 5:98774102-98774124 CCGCTGCCGCCGCCGAGGTTGAG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 994353898 5:98774119-98774141 GTTGAGCAGCGCCGCAGCCCCGG 0: 1
1: 0
2: 1
3: 11
4: 121
994353893_994353898 -3 Left 994353893 5:98774099-98774121 CCGCCGCTGCCGCCGCCGAGGTT 0: 1
1: 0
2: 12
3: 101
4: 771
Right 994353898 5:98774119-98774141 GTTGAGCAGCGCCGCAGCCCCGG 0: 1
1: 0
2: 1
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994353898 Original CRISPR GTTGAGCAGCGCCGCAGCCC CGG Exonic
900122540 1:1054952-1054974 GTGGGGCAGGGCCGCAGCTCTGG - Exonic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
901630616 1:10646448-10646470 GTTGAGCAGGACAGCAGCCCAGG - Intronic
901828634 1:11878940-11878962 GCTCAGCAGCGGGGCAGCCCGGG - Intergenic
908768324 1:67573574-67573596 GTGAAGCAGCTCCTCAGCCCAGG + Intergenic
1067702359 10:48583107-48583129 GGGGAGCAGAGCCGGAGCCCTGG - Exonic
1067920794 10:50455163-50455185 ATTGTGCAGTGCTGCAGCCCTGG - Intronic
1070269966 10:74944111-74944133 GTTGAGCAGTGATGCGGCCCAGG + Intronic
1071661233 10:87504968-87504990 CGAGAGCAGCGCCGCAGCCAGGG - Exonic
1075279083 10:121123326-121123348 ACTGAGCAGCACCACAGCCCTGG - Intergenic
1076756675 10:132576186-132576208 GAGGAGCAGAGCCACAGCCCCGG - Intronic
1082847335 11:57737136-57737158 GTTGAAAAGCACCGCAGGCCTGG + Intronic
1082986154 11:59172566-59172588 GCCGCGCAGCGCCGCAGCCCCGG + Exonic
1084040546 11:66540044-66540066 GGTGAGCACCTCCTCAGCCCTGG + Intronic
1086230939 11:84568958-84568980 GTTGAGCAGGGCTGCAGGCTAGG - Intronic
1087327996 11:96746801-96746823 GTTGGGCCGCTCAGCAGCCCAGG - Intergenic
1089253544 11:117181633-117181655 GTTGACCAGCCTCCCAGCCCAGG - Intronic
1090201840 11:124863252-124863274 GTTGAGCCGCGCCTCCGCTCAGG + Intergenic
1094375371 12:29783650-29783672 GGCCAGCAGCGCCGCGGCCCCGG + Exonic
1094564892 12:31590677-31590699 GCTCAGCGCCGCCGCAGCCCTGG + Intronic
1095986857 12:48004740-48004762 GGGGGGCAGCGCCGCAGCCCCGG - Intergenic
1096046400 12:48566355-48566377 GTTGCTCAGCTCCACAGCCCTGG - Intergenic
1098387665 12:69935846-69935868 ATAGAGCAGCCCCCCAGCCCTGG - Intronic
1102473609 12:113174721-113174743 GTGGAGCAGCACGGCAGCCTTGG + Exonic
1103913727 12:124365437-124365459 GATGAGCAGGGCCGATGCCCAGG + Intronic
1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG + Exonic
1112659917 13:101496248-101496270 GTTCAGCAGGGACACAGCCCTGG + Intronic
1113801972 13:113091453-113091475 GGTGACCAGCGCAGCAGCCGTGG - Intronic
1122275153 14:100587295-100587317 GGTGAGCGGCGCGGCTGCCCTGG - Intronic
1123529866 15:21134105-21134127 CTTGAGGAGCGCCAAAGCCCAGG - Intergenic
1124090947 15:26599408-26599430 GTTGAGCAGGGCTGCAGGCCAGG - Intronic
1124503953 15:30255696-30255718 GCTACGCAGCGACGCAGCCCTGG - Intergenic
1124739601 15:32282944-32282966 GCTACGCAGCGACGCAGCCCTGG + Intergenic
1127100966 15:55564550-55564572 GTGGAGCAGATCTGCAGCCCAGG + Intronic
1128322428 15:66702982-66703004 GTTGAGCAGCCCCGCCGCTGTGG + Exonic
1131389665 15:92036501-92036523 GTTAAGCAATGCCGCTGCCCAGG - Intronic
1132037763 15:98501070-98501092 GCTGAGCAGCTCCACATCCCAGG - Intronic
1132590561 16:724581-724603 GCTGAGCAGTGCCGGGGCCCTGG + Intronic
1132733852 16:1376078-1376100 GAGGAGGAGCGCCCCAGCCCTGG - Intronic
1132733873 16:1376140-1376162 GAGGAGGAGCGCCCCAGCCCTGG - Intronic
1132733905 16:1376238-1376260 GAGGAGGAGCGCCCCAGCCCTGG - Intronic
1133046593 16:3091742-3091764 GGTGAGCTGGGCCGCACCCCAGG - Exonic
1133130159 16:3671818-3671840 GGTGTGGAGGGCCGCAGCCCCGG - Intronic
1133343583 16:5055224-5055246 GGTGAGCTGCGCTGCTGCCCTGG - Exonic
1134046535 16:11104937-11104959 GTTCAGCAGCCCAGCAGCCCAGG - Intronic
1136721542 16:32322662-32322684 GTTGAGGAGCGCTAAAGCCCAGG - Intergenic
1137655122 16:50153128-50153150 GCTGCGCCGCGCAGCAGCCCGGG - Intronic
1140041609 16:71412066-71412088 GGGGAGCAGCACCACAGCCCAGG + Intergenic
1142236779 16:88926160-88926182 GCAGAGCAGAGCCGCAGCCGGGG + Intronic
1142403602 16:89873859-89873881 GGTGAGGAGCGCGGCGGCCCGGG + Exonic
1203004890 16_KI270728v1_random:195108-195130 GTTGAGGAGCGCTAAAGCCCAGG + Intergenic
1203136440 16_KI270728v1_random:1731227-1731249 GTTGAGGAGCGCTAAAGCCCAGG + Intergenic
1203150090 16_KI270728v1_random:1829235-1829257 GTTGAGGAGCGCTAAAGCCCAGG - Intergenic
1145326646 17:21836153-21836175 ATTGAGCAGCGCCACATCTCAGG - Intergenic
1145772451 17:27503315-27503337 GTTGAACAGCACAGCATCCCTGG - Intronic
1146787360 17:35731798-35731820 GGGGGGCAGCGCCGGAGCCCGGG + Exonic
1147833637 17:43314729-43314751 GTTGAGAAGAGCCTCGGCCCTGG - Intergenic
1151655170 17:75492440-75492462 GTGGAGGAGAGCCTCAGCCCGGG - Intronic
1152643891 17:81460123-81460145 GTGGAGCCGCCCTGCAGCCCAGG - Intronic
1152757486 17:82093024-82093046 GTAGAGCAGCACCTCAGGCCCGG + Intronic
1159056524 18:63471038-63471060 GTTGAGGAGAGCCCAAGCCCGGG - Intergenic
1160930324 19:1567176-1567198 GGGGAGCCGCGCCGCAGCCCAGG - Intronic
1162386754 19:10364733-10364755 GAAGGACAGCGCCGCAGCCCGGG + Exonic
925640627 2:5983012-5983034 GCTGAGCAGTTCCGGAGCCCTGG + Intergenic
926205321 2:10831246-10831268 GGAGGGCAGCGCCACAGCCCTGG - Intronic
927054266 2:19355382-19355404 GTTGAGCTGACCCTCAGCCCAGG + Intronic
927956792 2:27212409-27212431 GAGGAGCAGGGCGGCAGCCCAGG - Exonic
930711888 2:54557836-54557858 GCTGTGCAGCGCCACAGCCAGGG - Intronic
932497204 2:72151841-72151863 GTTGAGCTGTGCCGCAGCTTTGG - Intergenic
933956236 2:87375124-87375146 CTTGAGGAGCGCCAAAGCCCAGG + Intergenic
936323493 2:111486077-111486099 GTTGAGCTGAGGCTCAGCCCTGG + Intergenic
937044079 2:118841889-118841911 GGGGAGCTGCCCCGCAGCCCAGG + Intergenic
938105769 2:128528836-128528858 GCTGAGGAGCCCTGCAGCCCTGG + Intergenic
940453686 2:153871728-153871750 GGTGCGCACCGCCCCAGCCCGGG + Intergenic
944772997 2:202932905-202932927 GTTGAGCAGCTGCCCATCCCAGG - Intronic
946481684 2:220063089-220063111 TTTGAGCAGAGCCGAAGCCCAGG - Intergenic
946980464 2:225208443-225208465 CTTGAGCACCACCGGAGCCCAGG + Intergenic
947636166 2:231681554-231681576 AGTGAGGAGAGCCGCAGCCCGGG - Intergenic
948478194 2:238234653-238234675 GTTCAGCACCGCCGCCCCCCGGG - Intergenic
1170454519 20:16519884-16519906 GTTGAGCACCGCCTCACCCCGGG + Intronic
1170562673 20:17570295-17570317 GGTGAGCCGTGCCTCAGCCCGGG + Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172239267 20:33401406-33401428 GGTGAGCAGCGCGGCCGCCGGGG - Exonic
1173322258 20:41998695-41998717 CCTGCGCGGCGCCGCAGCCCTGG + Intergenic
1173725408 20:45293725-45293747 GTGGTGCCGCGCCCCAGCCCGGG + Exonic
1175536594 20:59719107-59719129 GTTTAGCAGCCCGACAGCCCCGG - Intronic
1176593906 21:8673479-8673501 CTTGAGGAGCGCCAAAGCCCAGG + Intergenic
1180276760 22:10650606-10650628 CTTGAGGAGCGCCAAAGCCCAGG + Intergenic
1181352765 22:22270261-22270283 CTTGAGGAGCGCCAAAGCCCAGG - Intergenic
1183517104 22:38272948-38272970 GGCGGGCGGCGCCGCAGCCCCGG + Exonic
1184620126 22:45671251-45671273 GTTGATCAGTGCCCCCGCCCGGG - Intergenic
1184871349 22:47240337-47240359 CTAGAGCATGGCCGCAGCCCTGG + Intergenic
1185011956 22:48319404-48319426 CATGAGCCGCCCCGCAGCCCAGG - Intergenic
1185021117 22:48376630-48376652 GTCCAGCCGCGCTGCAGCCCAGG - Intergenic
961414695 3:126748800-126748822 CCTGAGCAGGGCTGCAGCCCGGG + Intronic
967231150 3:187338572-187338594 ATTAAGCAGAGCCCCAGCCCAGG + Intergenic
976751429 4:88454533-88454555 GTTGAGCCGCTCAGCGGCCCAGG - Intergenic
978299021 4:107243774-107243796 GTTGAGCAGTGCAGTAGCACTGG - Intronic
983508786 4:168585729-168585751 GTTGAAAAGCTCCCCAGCCCAGG + Intronic
983881291 4:172936103-172936125 GTTGAGCAGCCTTGCATCCCAGG - Intronic
986252327 5:6071929-6071951 ATTGAGGAGCTCCACAGCCCTGG + Intergenic
986446878 5:7829207-7829229 GTTGTGCTGGGCCCCAGCCCCGG - Exonic
994353898 5:98774119-98774141 GTTGAGCAGCGCCGCAGCCCCGG + Exonic
999153472 5:149442014-149442036 GTTGCCCAAAGCCGCAGCCCCGG - Intergenic
1001083038 5:168680758-168680780 GCTGAGCAGCGAGGAAGCCCTGG - Intronic
1002590953 5:180291636-180291658 GGTGAGCAGGCCCGCAGCCCGGG + Intronic
1008730871 6:54481236-54481258 GTTTAGCAGCCCCACAGCCCTGG + Intergenic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1017720900 6:157242428-157242450 GATGGGCAGCGCCTGAGCCCGGG + Intergenic
1020106549 7:5424725-5424747 TGTGCGAAGCGCCGCAGCCCGGG - Intronic
1020175968 7:5882367-5882389 GTTGAGCATCCCCGTAGCTCAGG + Intronic
1024265114 7:47600444-47600466 GTTGGGCAGCTCGGCAGCCCAGG - Intergenic
1025852238 7:65252787-65252809 TTTGAGCTGCGCGGCAGTCCTGG + Intergenic
1026805126 7:73424472-73424494 GTGGACAAGCGCCGGAGCCCTGG - Intergenic
1027393475 7:77728534-77728556 GTTGAGCAGCGCCACACCATAGG - Intronic
1029082860 7:97988652-97988674 GTTGAGCATCCCCGTAGCTCAGG - Intronic
1029926933 7:104328521-104328543 GGTGAGGAGGGCCGGAGCCCGGG + Intergenic
1031219433 7:118945885-118945907 GCTGGGTAGCTCCGCAGCCCGGG - Intergenic
1036766524 8:11552848-11552870 GTTGAACAGTCCTGCAGCCCTGG - Intronic
1041076142 8:54171870-54171892 GTTGAGCAGAGCACCAGCCTGGG + Intergenic
1043527353 8:81111655-81111677 GGCGCGCAGCGCCGCCGCCCCGG + Exonic
1049817345 8:144612224-144612246 GGTGTGCAGCGGCGCAGCCGTGG - Intergenic
1049817369 8:144612368-144612390 GGTGTGCAGCGGCGCAGCCGTGG - Intergenic
1049817401 8:144612560-144612582 GGTGTGCAGCGGCGCAGCCGTGG - Intergenic
1049820507 8:144630416-144630438 GCTAAGAAGCGCCCCAGCCCTGG + Intergenic
1056475092 9:86945873-86945895 ATGCAGCAGCGCCGCTGCCCGGG + Exonic
1057623268 9:96655230-96655252 GGTTAGCGGCGCCGCCGCCCTGG - Exonic
1061274256 9:129560450-129560472 ATGGAGCAAAGCCGCAGCCCTGG + Intergenic
1061423179 9:130483372-130483394 GTTGGGCAGCGCCAGTGCCCTGG + Intronic
1062037849 9:134390654-134390676 GTTGAGCTCCGCCGCAGCCCTGG + Intronic
1062597530 9:137305952-137305974 GGTGAGCAGAGCAGCACCCCAGG - Intergenic
1187201017 X:17133859-17133881 GCTGAGCAGAGCCCCATCCCAGG + Exonic
1187419532 X:19122501-19122523 GGGGAGGAGGGCCGCAGCCCCGG - Exonic
1201751927 Y:17442005-17442027 GTTGAGCAGCCTTGCATCCCAGG + Intergenic