ID: 994355407

View in Genome Browser
Species Human (GRCh38)
Location 5:98788701-98788723
Sequence CAGGGAAGACACTTGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 361}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994355391_994355407 26 Left 994355391 5:98788652-98788674 CCAAAATCCACACTTCAGAATTA 0: 1
1: 0
2: 2
3: 22
4: 294
Right 994355407 5:98788701-98788723 CAGGGAAGACACTTGAAGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 361
994355393_994355407 19 Left 994355393 5:98788659-98788681 CCACACTTCAGAATTACCCTGGC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 994355407 5:98788701-98788723 CAGGGAAGACACTTGAAGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 361
994355399_994355407 3 Left 994355399 5:98788675-98788697 CCCTGGCGGGTAGGGAGGAGTGG 0: 1
1: 0
2: 2
3: 26
4: 266
Right 994355407 5:98788701-98788723 CAGGGAAGACACTTGAAGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 361
994355401_994355407 2 Left 994355401 5:98788676-98788698 CCTGGCGGGTAGGGAGGAGTGGG 0: 1
1: 0
2: 5
3: 45
4: 472
Right 994355407 5:98788701-98788723 CAGGGAAGACACTTGAAGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994355407 Original CRISPR CAGGGAAGACACTTGAAGGA AGG Intronic
900644767 1:3703907-3703929 CAGGGAAGACCTTTCCAGGAAGG + Intronic
901176064 1:7300227-7300249 TAGGGGAGACCCTTGGAGGAAGG - Intronic
901244723 1:7720781-7720803 CAGTGAAGACTCTGGAAGCAAGG - Intronic
902171605 1:14616007-14616029 CAGGAGAGACACTTGAAAGCTGG + Intronic
902680358 1:18039659-18039681 GCTGGAATACACTTGAAGGAGGG + Intergenic
902680539 1:18041072-18041094 ACTGGAATACACTTGAAGGAGGG + Intergenic
903220007 1:21864282-21864304 CTGGGAGGACACTGGAGGGAGGG - Intronic
903342897 1:22665715-22665737 CAGGGCAGTCACTTGATGGGAGG - Intergenic
903473183 1:23601535-23601557 CAGGGAAGCCTCTGGAAGGAGGG - Intronic
905354781 1:37373853-37373875 CCTGGAAGATGCTTGAAGGATGG + Intergenic
905400737 1:37701235-37701257 CAGGGTGGACACTAGAGGGAGGG + Intronic
907412579 1:54292950-54292972 CAGAGGAGACTCTTGGAGGATGG + Intronic
908633710 1:66138797-66138819 AAGGGAAAACACTTGAAAGAAGG - Intronic
909545524 1:76842288-76842310 CAGAGTAGAAACTGGAAGGAGGG - Intergenic
910208262 1:84769370-84769392 CCAGGAAGACTCTTGAAAGAGGG - Intergenic
910931222 1:92444341-92444363 AAGGGAAGACACAGGAAAGAAGG - Intergenic
911463788 1:98224982-98225004 CAGGGAAGGTCCTTGATGGAGGG - Intergenic
911728678 1:101269075-101269097 CAGGGAACCCACTTCAAAGAAGG + Intergenic
911758743 1:101591408-101591430 CAGAGAAAACAGTTGAATGAAGG - Intergenic
913210239 1:116576233-116576255 CATGGCAGACACCTGACGGAGGG - Exonic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915944233 1:160138046-160138068 CAGGGATGACACACGAAGGTGGG + Intronic
916215606 1:162390533-162390555 CCGGGAAGCCACCTGGAGGAAGG - Intergenic
917972437 1:180217389-180217411 AAGGGAAGACCCCTGAGGGAGGG - Intergenic
918099553 1:181361657-181361679 CAAGGCAGACACCTGTAGGAGGG - Intergenic
920340585 1:205272917-205272939 CAGGGAAGACACTGGGGGCACGG - Exonic
920915899 1:210257764-210257786 CAGGGAAAATACTGGCAGGAAGG + Intergenic
921100616 1:211925348-211925370 CAGGGAAGGCATTTGAATGTTGG - Intergenic
921605094 1:217142398-217142420 GAGGTAATACATTTGAAGGAAGG + Intergenic
921623073 1:217347823-217347845 CAGGGCAGAGATTTGAAGGTAGG - Intergenic
921635037 1:217482332-217482354 TAGGGAAGACACATAAAGCAGGG + Intronic
921768749 1:219007833-219007855 CAAGGCAGAAACTTGAAGGAGGG - Intergenic
921796666 1:219352643-219352665 CTGGAAGGACACTTGAAGAAAGG - Intergenic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
924544792 1:245016399-245016421 TTGGGCAGACACCTGAAGGAGGG - Intronic
924549139 1:245058047-245058069 CAGGCAAGAGTTTTGAAGGAGGG - Intronic
924606071 1:245536708-245536730 CAGGCAGAAGACTTGAAGGATGG + Intronic
1063378611 10:5570167-5570189 ACGGGGAGACACTTGAAGGAGGG + Intergenic
1065495920 10:26328089-26328111 CAGGGAAGCAACTGGAGGGAGGG + Intergenic
1066084430 10:31962576-31962598 AAGGAAATACACTTGAAAGAGGG + Intergenic
1067108937 10:43384934-43384956 CAGTGCTGACACTTGAAGCATGG + Intergenic
1067183451 10:44007418-44007440 CTGGGAAGGAACTTGAAAGAGGG - Intergenic
1067792139 10:49296413-49296435 CAGTGAAGCCACTGCAAGGATGG + Intergenic
1069747709 10:70726375-70726397 CAAGAAAGACACGTGGAGGAAGG + Intronic
1070467519 10:76738603-76738625 CAGGGAAAACACTCCAAGCATGG - Intergenic
1072100699 10:92226798-92226820 CAGGGAGGAGACCTGCAGGAGGG + Intronic
1072517311 10:96198174-96198196 AAGAAATGACACTTGAAGGAAGG + Intronic
1074103531 10:110372640-110372662 CCATGAAGACACTTTAAGGAAGG + Intergenic
1075454233 10:122574577-122574599 CACAGAAGACACTTGAAGTGAGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1078416795 11:11172618-11172640 CATAGAAGGCACTCGAAGGATGG + Intergenic
1078511095 11:11984828-11984850 CAGGGAAGAGACTGGAAGGCAGG - Intronic
1080516044 11:33021156-33021178 CAGGAAAATCACTTGAAGCAGGG + Intronic
1080741218 11:35066118-35066140 CAGGGAAAACAATTTAAGAAGGG - Intergenic
1081664286 11:44907373-44907395 CAGGGCAGGCTCTTGAAAGAGGG + Intronic
1081956840 11:47100214-47100236 CAGGGAATAAATTTGAGGGAGGG - Intronic
1082294690 11:50425329-50425351 CAGGGTAAAAACTGGAAGGAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082943362 11:58732202-58732224 CAGGCCAGATACTGGAAGGAGGG + Intergenic
1083027421 11:59562397-59562419 CAGAGAAATCACTAGAAGGAAGG + Intergenic
1086571045 11:88285001-88285023 CTGGGAAGACACTTGCTGAAAGG + Intergenic
1087006254 11:93475005-93475027 CATGAAGGACACATGAAGGATGG + Intergenic
1087435223 11:98108063-98108085 CAGGAAAGCCACTTAAAGAATGG + Intergenic
1087828649 11:102794697-102794719 CAGGGGAGATAATTAAAGGATGG + Intronic
1088575182 11:111264750-111264772 GAGGGAAGAGACAGGAAGGAAGG + Intronic
1088637218 11:111834177-111834199 TACTGAAGACACTTAAAGGAAGG + Intronic
1088922583 11:114271953-114271975 CAGAGAAGGAACTGGAAGGAGGG + Intronic
1089645755 11:119877611-119877633 CATGGAAGAGAATTAAAGGAAGG - Intergenic
1090268594 11:125370395-125370417 CATGGATGTCACTTGAAGAATGG + Intronic
1090434528 11:126675776-126675798 AAGGGAAGTCATTTGAAGCAGGG + Intronic
1090471469 11:126984848-126984870 CAGGGAGGAGACCTGGAGGAGGG + Intronic
1091470538 12:722505-722527 CAGGGAAGACACTTGAGCTCAGG + Intergenic
1091788050 12:3254968-3254990 CAGGGGAGAGGCTGGAAGGAGGG + Intronic
1091788295 12:3256355-3256377 CAGGGAAGGCACTTGCCGCAGGG + Intronic
1092069172 12:5618783-5618805 CAGTGAAGCTCCTTGAAGGAAGG - Intronic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1092995315 12:13944202-13944224 CATGGAAGGCACTTATAGGAAGG - Intronic
1093481955 12:19613031-19613053 CAGGTAAGACACATTCAGGAAGG - Intronic
1093507322 12:19883304-19883326 AAGGGAAGAGACTAGAAAGAGGG + Intergenic
1093744280 12:22722000-22722022 CACGGAAGAAACTTGGAGGTAGG + Intergenic
1094485845 12:30925892-30925914 CAGGGAAGCCACTGGAGGCAGGG - Intergenic
1095659451 12:44713363-44713385 CAGAGAAGTTACTTCAAGGAGGG - Intronic
1097129166 12:56797613-56797635 CAGGGAAGCCTCTTGAAATAAGG + Intergenic
1099337567 12:81382901-81382923 AAGGGAAGACACTCCAAGGTCGG + Intronic
1099842592 12:87984505-87984527 CATGGAAGTCACTTCATGGAAGG - Intronic
1100780681 12:98022972-98022994 CCTGGAAGACACAGGAAGGAGGG - Intergenic
1101885706 12:108659956-108659978 TGGGGCAGACCCTTGAAGGAAGG - Intronic
1102554805 12:113719812-113719834 CAGGGAAGCTTCTTAAAGGAAGG + Intergenic
1103892363 12:124249538-124249560 CAGCTAAGACACCTGAGGGAGGG + Intronic
1104103846 12:125640471-125640493 CAGTGAAGACACATGAAGAGGGG + Intronic
1104145091 12:126025409-126025431 TAGGGAAGACACTTTTAAGATGG + Intergenic
1106123684 13:26882747-26882769 CAGTGAAGAGGCTGGAAGGACGG - Intergenic
1106458375 13:29947295-29947317 CAAGGAAGACCCCCGAAGGAAGG - Intergenic
1106756849 13:32830250-32830272 CAGGGAAGAATCTTGAGTGATGG - Intergenic
1107911106 13:45106579-45106601 TAGCCCAGACACTTGAAGGATGG + Intergenic
1108530526 13:51323408-51323430 CAGATCAGACACTTGAGGGATGG + Intergenic
1109383544 13:61597723-61597745 GAGAGAAGTCACTGGAAGGATGG + Intergenic
1111859164 13:93679923-93679945 CAGTGCAGACATTTCAAGGAAGG + Intronic
1111885936 13:94020619-94020641 CAGGGAGGGCTCTTGAAGGAAGG - Intronic
1112241976 13:97691182-97691204 TAGGGAACACACTTTAGGGAAGG + Intergenic
1115341134 14:32294052-32294074 CTTGGAGGAGACTTGAAGGAAGG - Intergenic
1115708860 14:36028050-36028072 AAGAGAAGAGACTTGAAGGAGGG - Intergenic
1116375615 14:44196313-44196335 CAGGGAAGAAACTTCAGGGAAGG - Intergenic
1117388801 14:55243515-55243537 CAGGGGGCACATTTGAAGGAAGG - Intergenic
1117399718 14:55347617-55347639 CAGGGAACAGACGTGAGGGAAGG - Intronic
1119453677 14:74735660-74735682 CAGGAGAATCACTTGAAGGATGG - Exonic
1119644165 14:76336578-76336600 CAGGAAAGACAATAGAAGGAAGG - Intronic
1120979698 14:90278984-90279006 CCGGGAAGACACTAGCTGGACGG + Intronic
1121261562 14:92570011-92570033 CAGGGATGGCACAGGAAGGAAGG - Intronic
1121441469 14:93952379-93952401 CAGGGAAGACACTTCCATGGTGG + Intronic
1121497956 14:94410158-94410180 CAGGGAAGACAATAAAAGGAGGG - Intergenic
1121630091 14:95415586-95415608 GAGGGAAGGAACTTGATGGAAGG + Intronic
1121991871 14:98565826-98565848 CATGGAAGACAGTGGAAGGAAGG - Intergenic
1124403064 15:29367253-29367275 CCTGGAAGCCACTTGAGGGAAGG + Intronic
1124475039 15:30025833-30025855 TGGGGCAGACACTTGAGGGATGG + Intergenic
1125718785 15:41835256-41835278 CAGGGAAGATATGGGAAGGAGGG + Intronic
1125871498 15:43106098-43106120 CAGGGACGACACTTTTACGACGG + Exonic
1126566488 15:50106146-50106168 CAGGGACGATATTGGAAGGAAGG + Intronic
1126686695 15:51254559-51254581 CAGGCAAGAAATATGAAGGATGG - Intronic
1126835767 15:52663176-52663198 CAGGGAAGGGAATGGAAGGAAGG - Intronic
1127231875 15:57005441-57005463 TATGGGAGACAGTTGAAGGAAGG - Intronic
1127309030 15:57735625-57735647 CCAGGAAGACACCAGAAGGATGG + Intronic
1129659023 15:77542857-77542879 CAGGGAAGCCTCCTGAAGGAGGG - Intergenic
1130346201 15:83047898-83047920 GTGGGAAGACACTGGAAGCAAGG + Intronic
1130706535 15:86238063-86238085 CAGGGAAGACCCTTGAGGAGGGG - Intronic
1130868078 15:87949126-87949148 CAGGGAAAACACTGCAAAGAGGG + Intronic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131054263 15:89366382-89366404 CAGGTAAAACCCTTGCAGGATGG - Intergenic
1131326277 15:91449871-91449893 CAGGGAACACACCTGCAGGGAGG - Intergenic
1132568063 16:632174-632196 CAGGGAGGACAGTGGATGGAAGG - Intronic
1133446096 16:5862364-5862386 CAGGGATGGCACTTGAGGGAGGG + Intergenic
1133864224 16:9626797-9626819 CAAGGGAGACACTGGATGGAGGG + Intergenic
1133942525 16:10322283-10322305 AAGGAAAGAAACTTGAAAGAAGG + Intergenic
1134776506 16:16858295-16858317 CAGGGAAGAAACTGGGAGGGTGG - Intergenic
1136091080 16:27920514-27920536 CGGGGAAAACACTTGCAGCAGGG - Intronic
1137479452 16:48839702-48839724 CAAGGCAGAAATTTGAAGGATGG - Intergenic
1137922475 16:52504607-52504629 CAGAGATGAGACTTAAAGGATGG + Intronic
1137980135 16:53062512-53062534 CAGGGAGGTCACTTGAAGCCAGG + Intronic
1139758973 16:69168957-69168979 CAGGGTAGACAGTTCAAGGAAGG - Exonic
1140194196 16:72843546-72843568 CAGTGAGGAAACCTGAAGGAGGG + Intronic
1140896783 16:79331719-79331741 CAGGGAAGACACTGGAAATGTGG - Intergenic
1140984487 16:80144932-80144954 CAGAGTTGACACTTGAAGAATGG - Intergenic
1141324090 16:83039333-83039355 CAGGAATGAGACTTGAAAGAAGG - Intronic
1142499988 17:326883-326905 AAGGGAAGAAACTGGAAGCAAGG + Intronic
1142677297 17:1521747-1521769 AAAGCAAGACACTGGAAGGACGG + Intronic
1142678921 17:1534128-1534150 CATGGACGACATTCGAAGGATGG - Exonic
1142941569 17:3384081-3384103 CAGGGAAGCTCCTTGCAGGAAGG - Intergenic
1144824964 17:18100669-18100691 CCTGAAAGACACGTGAAGGAGGG + Intronic
1147383904 17:40070905-40070927 GAGGAGAGACACATGAAGGAGGG - Intronic
1151276855 17:73041348-73041370 GAAGGAAGAGACTAGAAGGAAGG + Intronic
1151608172 17:75153659-75153681 AAGGGGAGACACTTGGAAGAGGG + Intronic
1151947955 17:77329733-77329755 CTGGGAAGAAACCTGAAGGATGG - Intronic
1152521398 17:80858756-80858778 CTGGGAAGACATTTAGAGGAGGG + Intronic
1155913867 18:31536838-31536860 CAGGGAATAATGTTGAAGGAAGG - Intronic
1155925841 18:31653767-31653789 CAGGTAACACACTTGGAGAAAGG - Intronic
1156475835 18:37404791-37404813 CAAGGAAGATGCTAGAAGGAGGG - Intronic
1156588569 18:38460324-38460346 CAGGGAAGTCTCCTGAAGGTGGG - Intergenic
1156765915 18:40654705-40654727 CTGGGAAGACAATAGAATGAAGG - Intergenic
1157453146 18:47802788-47802810 GAGGGAAGACAGTTGGAGAAAGG + Intergenic
1157978488 18:52353335-52353357 GAGGAAAGAGAGTTGAAGGAGGG - Intronic
1158043293 18:53124018-53124040 CAGGGAAGGCACTTCAGGGATGG - Intronic
1160572137 18:79825323-79825345 AAAGGAAGACACTTGAAGAATGG + Intergenic
1161800922 19:6416397-6416419 CAGAGAGGACCCTAGAAGGAAGG + Exonic
1164540765 19:29120020-29120042 AAGGGAGGACAATTGAAAGAGGG + Intergenic
1165611064 19:37153296-37153318 GAGGGACGACACTTGAAAAAAGG + Exonic
1165778308 19:38417825-38417847 CAGGGAAGACACCAGAGGAAGGG + Intronic
1166458463 19:42965056-42965078 CAGAGAAGACATTGGAAGTAGGG - Intronic
1166718331 19:44983273-44983295 CAGGATAGAGACTTGAGGGAGGG + Intronic
1166804611 19:45477999-45478021 TAGGGCAGACCCTTGAAGGATGG - Intronic
1167129002 19:47572515-47572537 AAGGGAAGTTACTTAAAGGAGGG + Intergenic
1167810362 19:51824459-51824481 CAGCGAAGACACGTAAGGGACGG - Exonic
1167946356 19:52992279-52992301 CAGGGAGGACACCTGGAGGTCGG - Intergenic
1167963606 19:53126550-53126572 CAGGCAGGAGACTTGAGGGAGGG + Intronic
925209181 2:2032512-2032534 CAGAGAAGATTCTAGAAGGAGGG + Intronic
925209195 2:2032576-2032598 CAGAGAAGATTCTAGAAGGAGGG + Intronic
925626418 2:5846048-5846070 CAGGGAGCATACTTGAAGGTTGG + Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
928341702 2:30448086-30448108 CAGGGAAGCCACCTGAACCAGGG - Intronic
928548225 2:32348014-32348036 CAGGGAAGACTCTGAAAGGGTGG - Intergenic
929021194 2:37554968-37554990 GAGGAAAGAGACTTGCAGGAAGG + Intergenic
929663792 2:43817255-43817277 CAGGGAAATCACTTGAAGTCAGG + Intronic
930662006 2:54063890-54063912 CAGGGGAAATATTTGAAGGAAGG + Intronic
931358128 2:61554857-61554879 CAGCAAAGACACTGGAGGGATGG - Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936650013 2:114414923-114414945 AAGGGAAGACACTGGAAACAAGG - Intergenic
937538527 2:122921181-122921203 CTCTGAAGACACTTGAGGGAAGG + Intergenic
938181606 2:129189747-129189769 CAGGGAAGACTGTGGCAGGAAGG + Intergenic
938321379 2:130367999-130368021 CAGGGTAGACACTAGAAGAAAGG - Intronic
938641695 2:133287781-133287803 GAGGCAGGAAACTTGAAGGATGG + Intronic
941038342 2:160591235-160591257 AAGGGAAGATACTGGAGGGAAGG - Intergenic
941531630 2:166677971-166677993 CAGGGAGGACACTAGCAGAAAGG - Intergenic
942098235 2:172554225-172554247 CAGGGAATAATCTAGAAGGAAGG + Intergenic
942554989 2:177162836-177162858 CAATGAACACATTTGAAGGAAGG - Intergenic
943506404 2:188765435-188765457 GAAGGAAGACACAGGAAGGAAGG - Intronic
944521224 2:200569515-200569537 CAATGAAGACACTTAAAGGTAGG - Intronic
945321085 2:208424469-208424491 CAGGGCAGACCCATGAAGGCAGG - Intronic
946004767 2:216514382-216514404 CATGGATGAGACTTGAAGGAAGG + Intronic
946189601 2:218001479-218001501 CAGGGGTGACACAAGAAGGATGG - Intronic
946226299 2:218265759-218265781 CAGTGAAGACCCAGGAAGGAAGG + Intronic
946336287 2:219038777-219038799 CAGGGAAGGCACTCCAAAGAGGG + Intronic
946721697 2:222615621-222615643 TTGAGCAGACACTTGAAGGAAGG - Intronic
947390612 2:229635534-229635556 CAGGAAAGGCAACTGAAGGAGGG + Intronic
947406412 2:229781897-229781919 CAGGTAAGACCCATGAAGGAAGG + Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
1168758042 20:329395-329417 CAGGAAAGCAACTTAAAGGAGGG + Exonic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1172673932 20:36654167-36654189 CAGGGAGGAGATTTGTAGGATGG + Intronic
1173359278 20:42325935-42325957 AAGGGAAGACCATTCAAGGAAGG - Intronic
1173638529 20:44582345-44582367 CAGGGTTGAAAATTGAAGGAAGG + Intronic
1174712488 20:52722130-52722152 CATGGAAGACATTTGCAGGTAGG + Intergenic
1174849960 20:53984370-53984392 CTGGGAAGAACCTGGAAGGAAGG + Intronic
1175290410 20:57871476-57871498 CAGCGGAGACACTGGAAGAAGGG - Intergenic
1177132739 21:17277743-17277765 CATGGTAGATACTTGAAGGTAGG + Intergenic
1180877629 22:19182166-19182188 CAGGAAAGACACCCGAGGGATGG + Intronic
1181660200 22:24341167-24341189 CAGGGCAGATACTGGGAGGAGGG + Intronic
1183086909 22:35492088-35492110 CAGGGAGTACACTTGAGGCAGGG - Intergenic
1183086940 22:35492195-35492217 CAGGGAGCACACCTGAGGGAGGG - Intergenic
1183622444 22:38982337-38982359 CTGGGAGGTCACTTTAAGGAGGG + Intronic
1183628898 22:39021404-39021426 CCGGGAGGTCACTTTAAGGAGGG + Exonic
1184781139 22:46650278-46650300 CAGGGAAGTTACTGGGAGGAAGG - Intronic
952766543 3:36959104-36959126 GAAGGAATACACATGAAGGAGGG - Intergenic
952969947 3:38644474-38644496 CAGGGAAGACAAGTGACGGCAGG + Intronic
953240556 3:41144939-41144961 AAGGGAAGACATTAGAAGAATGG + Intergenic
953413522 3:42702843-42702865 CAGGGAGGATCCTTGAAGGGGGG + Intronic
954220959 3:49153663-49153685 CAGGGATGACAGTAGAAGAAGGG + Intergenic
954363331 3:50133828-50133850 CAGGGAAGAGGTTTCAAGGAGGG + Intergenic
955627878 3:60938541-60938563 CAGGGAAGACATTTACAGGAAGG - Intronic
956268032 3:67419944-67419966 CAGAAAAGACACTGCAAGGAAGG + Intronic
956690916 3:71876995-71877017 CAGGGAGGAGACTGGAGGGATGG + Intergenic
956790262 3:72674607-72674629 CAGGGAAGGCAAGTGAAGGTTGG + Intergenic
957310955 3:78518086-78518108 CAGGGAAGACACTGCAGGCAAGG - Intergenic
957923987 3:86784650-86784672 CAGGGAAGCCAACTGAAGGCAGG - Intergenic
958666702 3:97148850-97148872 CAGGGAACACATTTGAGGGGTGG + Intronic
958868753 3:99532434-99532456 CTGGGAAGATGCTGGAAGGAAGG - Intergenic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
959578040 3:107956204-107956226 GAGGGAAGAAACTTACAGGAGGG - Intergenic
961200411 3:125041078-125041100 TAGGAAAGACACTGGAATGAAGG - Intronic
962147589 3:132856667-132856689 CAGGGGAGTCAGTTGAATGATGG + Intergenic
962147678 3:132857473-132857495 CAGGGGAGTCAGTTGAATGATGG + Intergenic
962756896 3:138471994-138472016 AAGGGAAGACCCATGAAGGTGGG - Intronic
962795375 3:138845259-138845281 CAGTGAGGGCACTTGAAGGGCGG + Intergenic
963071484 3:141308676-141308698 CAGGGTGGAGACGTGAAGGAAGG + Intergenic
963599379 3:147364657-147364679 AGGGGAAGACACTTGAGGCAAGG + Intergenic
964389032 3:156178500-156178522 CATGGAAGAAAATTGAAGAAAGG + Intronic
964554709 3:157923949-157923971 GAGGGTAGACAGTAGAAGGAGGG - Intergenic
965286334 3:166824697-166824719 CTGGGTAGGCACTGGAAGGAAGG + Intergenic
965691802 3:171365273-171365295 CAGGAAAATCACTTGAACGAGGG - Intronic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
966774317 3:183530748-183530770 GAGACAAGACAATTGAAGGAAGG + Intronic
966836976 3:184056802-184056824 CAGGGGAGACCCCAGAAGGAAGG + Intronic
967049794 3:185772268-185772290 TAGGGAAAACTCTTTAAGGAAGG - Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968098150 3:195946757-195946779 AGGGGAAGACACATGATGGATGG - Intergenic
969300514 4:6294450-6294472 CATGGCAGACACTTGTTGGATGG + Intronic
970083201 4:12314083-12314105 CAGGGTAGAAAGTGGAAGGAGGG + Intergenic
970479603 4:16459711-16459733 CAGGGCAGCAACTTGTAGGAAGG + Intergenic
970684698 4:18553674-18553696 CAGTGAAGCCACGTGATGGAAGG - Intergenic
971699781 4:29956164-29956186 CAAGGAAAACAGCTGAAGGAGGG - Intergenic
972088452 4:35250248-35250270 CAAAGAAGACATTTGAAGAATGG - Intergenic
972568719 4:40291766-40291788 CGGGGAAGACACATGCAGGATGG - Intergenic
973547992 4:52001390-52001412 CAGGGAAGAGGCTTGAAAGGAGG + Intronic
975462666 4:74672572-74672594 CAAGGAAGAAACTTTAAAGATGG - Intergenic
975714788 4:77195249-77195271 CAGGGAAGGCTCCTGCAGGATGG + Intronic
978338568 4:107696870-107696892 CATTGTAGACACTTGTAGGATGG - Intronic
980277703 4:130676665-130676687 CAGAGATGACCCTTCAAGGAAGG + Intergenic
980967714 4:139539179-139539201 AAGGGAACACAGTGGAAGGAAGG - Intronic
981527737 4:145723126-145723148 CAGGGAAGACAATGGAAACATGG - Intronic
983004174 4:162462567-162462589 CAGTTAAGACAGTTGAAGCAGGG - Intergenic
986335421 5:6751449-6751471 CAGTGAGGAAACTTGCAGGAAGG - Intronic
986710906 5:10487155-10487177 CAGGGAAGACCCTGGAGGGGAGG - Intergenic
987917932 5:24240353-24240375 AAGGGGAGAGATTTGAAGGAGGG + Intergenic
988578126 5:32445562-32445584 TAGGGAGACCACTTGAAGGAAGG + Intergenic
990647018 5:57856653-57856675 CAGGGAAATCACTTGAACCAGGG - Intergenic
990702949 5:58495288-58495310 GAGGGAGGACAGTGGAAGGAGGG + Exonic
990766101 5:59184679-59184701 CAGGGAAAGCATTTGAAAGATGG - Intronic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
992859816 5:80898794-80898816 CAGGGAAGTCACATAAGGGAAGG - Intergenic
993315505 5:86400636-86400658 CAGTGAAGACACTTAAATGTTGG - Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994355407 5:98788701-98788723 CAGGGAAGACACTTGAAGGAAGG + Intronic
995347025 5:111133125-111133147 CTAGGAAGAAACCTGAAGGAAGG + Intergenic
996326533 5:122281042-122281064 CAAGGAAGAGACTTGATGGGAGG + Intergenic
996879336 5:128276922-128276944 CAAGGAGGACAATTCAAGGAGGG - Intronic
997247041 5:132358493-132358515 CAGAGAAGACAACTGCAGGAGGG - Intergenic
997896981 5:137727658-137727680 CAGGGAAGAGGCTTGAAGGCTGG - Intronic
998256422 5:140592004-140592026 CAGGTGAGACCCTTGAGGGAGGG - Intronic
999343300 5:150792361-150792383 CAGTGAACTCACTAGAAGGAGGG + Intronic
999496534 5:152104432-152104454 CTGGGAAGGCACCAGAAGGAAGG - Intergenic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1001294315 5:170488426-170488448 GATGGAAAACCCTTGAAGGAAGG - Intronic
1001408616 5:171494921-171494943 CAGGGAAGCCCCTTGTAGGGAGG - Intergenic
1001639746 5:173236066-173236088 CAGGGAGGGCACGGGAAGGAGGG - Intergenic
1002080890 5:176736735-176736757 CAGGGAGGACAGGAGAAGGAAGG - Intergenic
1002397182 5:178967113-178967135 CTGGGATGGCACCTGAAGGAGGG + Intergenic
1002961896 6:1923216-1923238 TAGTGTGGACACTTGAAGGATGG - Intronic
1003637652 6:7847739-7847761 CAGGGAAGATTCTTGCAAGATGG + Intronic
1003744746 6:8987831-8987853 CAGTGTGGACACTTAAAGGAGGG - Intergenic
1004459817 6:15825449-15825471 AAGGGAAGAAACCAGAAGGAAGG - Intergenic
1004479536 6:16005649-16005671 CAAGGATGACACATGAAGGTTGG - Intergenic
1005400349 6:25425916-25425938 TATGGAAGACAGTAGAAGGACGG + Intronic
1005583082 6:27251547-27251569 CAGGGAAGACCCGAGAAGGAGGG + Intronic
1006379128 6:33687610-33687632 CAGGGAGGACACTTGACCCAAGG + Intronic
1007265606 6:40593571-40593593 GGTGGATGACACTTGAAGGATGG + Intergenic
1007958841 6:45940802-45940824 CAGGTATAACACTTGAAGAACGG - Intronic
1008063185 6:47020119-47020141 TAGGGCAGAAACTTGAAAGAAGG - Intronic
1008919857 6:56831502-56831524 CAGGGCTGGCATTTGAAGGAAGG - Intronic
1009064486 6:58441962-58441984 CAGGATAGAAACTTAAAGGAAGG + Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1011017196 6:82769994-82770016 TTGGGAGGACACTAGAAGGATGG + Intergenic
1011433144 6:87309369-87309391 CAGGGAAGACTCTGGAAGGCTGG - Intronic
1011750588 6:90451060-90451082 CATGGAAGCCACTTTAAGGTAGG + Intergenic
1011997640 6:93613289-93613311 GAGGGAAGACATTGGAAGAAGGG + Intergenic
1014732211 6:125046036-125046058 CTTTGAGGACACTTGAAGGAGGG + Intronic
1015353928 6:132254895-132254917 CAGGCAAGACAATTCATGGATGG + Intergenic
1016171765 6:141026489-141026511 CAGGTAAGGCACTGGAATGATGG - Intergenic
1016956520 6:149632280-149632302 CAGGGAAGTCACTTGAACCCGGG + Intronic
1017171293 6:151457465-151457487 TAGGGAAGAGATTTGGAGGAGGG + Intronic
1018049067 6:159991966-159991988 CAGGGCAGATGCCTGAAGGAAGG + Intronic
1018640935 6:165903510-165903532 CAGAAAAGACAATTGGAGGAAGG + Intronic
1018911970 6:168106451-168106473 GAGGGAGGACACGTGAAGGAAGG + Intergenic
1019062080 6:169263727-169263749 CAGAGAAGACCCTTGGAGGAGGG - Intergenic
1019917941 7:4145243-4145265 CAGGGAAGACAAAGGAGGGAAGG + Intronic
1021390368 7:20085603-20085625 CCTGGAAGACAAGTGAAGGAAGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1023205359 7:37743043-37743065 CACTGAAGACACTGGAAGTATGG - Intronic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024246688 7:47476091-47476113 CAGGGAAGACACGTGATGTGTGG - Intronic
1026595739 7:71732999-71733021 GAGGGAAGAAAAATGAAGGAGGG + Intergenic
1028788789 7:94828952-94828974 CAGGTAAGTCACTTGAACCAGGG - Intergenic
1029097947 7:98104113-98104135 CAGGACAGACACTGGCAGGAGGG + Intergenic
1029861144 7:103573450-103573472 AAGGGAAGGAAATTGAAGGAAGG + Intronic
1030120951 7:106110339-106110361 CTGAGAGAACACTTGAAGGATGG - Intronic
1031694321 7:124830855-124830877 CATGGAATACACTAGAAGTATGG + Intronic
1033237537 7:139650024-139650046 CAGGGAAGACAGTTCTAAGATGG + Intronic
1034383371 7:150718470-150718492 CAGGTCAGCCACTTGAAGGTGGG + Intronic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035890002 8:3332970-3332992 CAGGGAAAGCCCTTGAAAGAGGG + Intronic
1035919212 8:3658688-3658710 CAGGGGAAACACTTGAACGCAGG + Intronic
1036090239 8:5657278-5657300 CAGAGAAGCCAGGTGAAGGAAGG - Intergenic
1036631566 8:10519451-10519473 CTGGGAAGACACCTGAAGGAAGG - Intergenic
1037151578 8:15641487-15641509 AGGGGAAGACACTAGAAGTAAGG + Intronic
1037325063 8:17680820-17680842 CTGAGCAGACACATGAAGGAAGG + Intronic
1037994613 8:23343266-23343288 CAAGGAAGACACTTGACATAGGG - Intronic
1038207915 8:25486335-25486357 CAGGGAAGACACCTGAATAAAGG - Intronic
1039998299 8:42554635-42554657 CAGGGAAGAGACTTCAAAGCCGG - Intergenic
1040023363 8:42760070-42760092 CAGCTAAGACACATGAAGGCAGG - Intronic
1041007183 8:53507040-53507062 CAGCGAAGAGAATTCAAGGAGGG - Intergenic
1041080497 8:54210778-54210800 CAGGAAAGTCACTTGAATGCAGG - Intergenic
1041518798 8:58732062-58732084 CAGGGAAGAAACTGGTAGGGTGG - Intergenic
1042349938 8:67766888-67766910 CAGGGAAGAGACTGAAAGAAAGG - Intergenic
1042669313 8:71244068-71244090 CAGGGCAGACTCTTGTAAGATGG - Intronic
1042678523 8:71351226-71351248 GAGGGAAAACAGTTGAAAGACGG + Intronic
1044299061 8:90562799-90562821 GAGGGAAGACAATGGAAGGAGGG - Intergenic
1044766928 8:95586348-95586370 CAGGAAAGGCACTTAAGGGAGGG + Intergenic
1045718832 8:105081577-105081599 GAGGGAAGAGGCTAGAAGGAAGG + Intronic
1046542906 8:115609804-115609826 CATGGAAAACACTTCATGGAAGG - Intronic
1047398273 8:124523796-124523818 GAGGGAAGACAGTGTAAGGAAGG + Intronic
1048997012 8:139800733-139800755 GAGGGAAGATACTGGAGGGAGGG - Intronic
1048997117 8:139801056-139801078 GAGGGAAGATACTGGAGGGAGGG - Intronic
1048997122 8:139801074-139801096 GAGGGAAGATACTGGAGGGAGGG - Intronic
1052181182 9:25530481-25530503 GAAGGAAGACACTTTAAGTAAGG + Intergenic
1052792284 9:32886821-32886843 CAGCCAAGACCCTTGAAGAAGGG + Intergenic
1053455709 9:38231804-38231826 CAAAGAAGACACTCGAAGGAAGG - Intergenic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1055548237 9:77405068-77405090 GAAGAAAGACATTTGAAGGAAGG + Intronic
1056405881 9:86274639-86274661 CAGGAAAAACACCTGAAGGTTGG - Intronic
1057236636 9:93366470-93366492 CAGTGAGGACACTGGATGGAAGG + Intergenic
1057244246 9:93440789-93440811 CTGGGAAGTCACTTGACGGGGGG - Intergenic
1058044202 9:100338458-100338480 AAGGGAAGAAGCTTGGAGGAAGG - Intronic
1058215685 9:102230697-102230719 CAGGACAGAAACTGGAAGGAAGG - Intergenic
1059766095 9:117385496-117385518 CAGAGAAGAGCCTTGAAAGATGG + Intronic
1060638478 9:125219066-125219088 CAGGTAAGAGAATTGAAGTAGGG - Intronic
1185818580 X:3180271-3180293 CAAGGAAGGCTCTTGGAGGATGG + Intergenic
1186148073 X:6645657-6645679 CATGGAAGACAATTGAATCATGG + Intergenic
1186185001 X:7012120-7012142 CAGAGAAGACATTAGAAGTAGGG - Intergenic
1186990879 X:15066061-15066083 CAGGAAAGACACTTATAAGAAGG + Intergenic
1187674198 X:21699700-21699722 CAGGGAAGGCAACTGAAGGGAGG - Intergenic
1189593195 X:42537207-42537229 CAGGGAAGAGATTGGAAGAAAGG - Intergenic
1189671918 X:43420212-43420234 GAGAGAATACACTTGGAGGAGGG + Intergenic
1190739137 X:53277526-53277548 TAGGGAAGAAACTTAAAAGATGG - Intronic
1191137781 X:57084094-57084116 CAGAGTAGACAAGTGAAGGAAGG + Intergenic
1191266951 X:58405903-58405925 CAGGAGAGAAACTAGAAGGAAGG + Intergenic
1191269150 X:58440185-58440207 CAGGGTAAAAACTAGAAGGAAGG - Intergenic
1191807487 X:65150467-65150489 CAGGGAAGGAACTTAGAGGATGG - Intergenic
1192059595 X:67810458-67810480 CAAGTAATACACTTGAAGGCAGG + Intergenic
1192503788 X:71668945-71668967 CTGGGAAGAAACCTGCAGGAAGG + Intergenic
1192601857 X:72472991-72473013 GAGGGAAGAGACTTGAGGCAGGG - Intronic
1192804631 X:74497850-74497872 GGGGGATGACACTGGAAGGAAGG + Intronic
1193122316 X:77836409-77836431 AAGGGTAAATACTTGAAGGATGG + Intronic
1194638536 X:96375094-96375116 CAGAGAAGGCACCTGAGGGAAGG - Intergenic
1194819636 X:98489913-98489935 CATGGAAGACAGTGGAAGAAGGG + Intergenic
1197665382 X:129217553-129217575 CAGGGAAGTCACTTCAGGAAGGG - Intergenic
1198217475 X:134569152-134569174 CAGGAAAGATGCTTGAGGGAGGG - Intronic
1201756485 Y:17492286-17492308 CAGGGGAGTCACTTGAACCAGGG - Intergenic
1201845067 Y:18413699-18413721 CAGGGGAGTCACTTGAACCAGGG + Intergenic