ID: 994355840

View in Genome Browser
Species Human (GRCh38)
Location 5:98793153-98793175
Sequence CATCCACAAAGGCGGCCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994355840_994355846 -7 Left 994355840 5:98793153-98793175 CCTGCCGGCCGCCTTTGTGGATG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 994355846 5:98793169-98793191 GTGGATGGCACCACCAGTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 148
994355840_994355848 -5 Left 994355840 5:98793153-98793175 CCTGCCGGCCGCCTTTGTGGATG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 994355848 5:98793171-98793193 GGATGGCACCACCAGTGGTGGGG 0: 1
1: 0
2: 2
3: 13
4: 138
994355840_994355847 -6 Left 994355840 5:98793153-98793175 CCTGCCGGCCGCCTTTGTGGATG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 994355847 5:98793170-98793192 TGGATGGCACCACCAGTGGTGGG 0: 1
1: 0
2: 1
3: 7
4: 125
994355840_994355853 30 Left 994355840 5:98793153-98793175 CCTGCCGGCCGCCTTTGTGGATG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 994355853 5:98793206-98793228 AGAGCCTGCGTATCGTGGAAAGG 0: 1
1: 0
2: 0
3: 0
4: 43
994355840_994355851 25 Left 994355840 5:98793153-98793175 CCTGCCGGCCGCCTTTGTGGATG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 994355851 5:98793201-98793223 TGCCAAGAGCCTGCGTATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 41
994355840_994355845 -10 Left 994355840 5:98793153-98793175 CCTGCCGGCCGCCTTTGTGGATG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 994355845 5:98793166-98793188 TTTGTGGATGGCACCACCAGTGG 0: 1
1: 0
2: 3
3: 19
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994355840 Original CRISPR CATCCACAAAGGCGGCCGGC AGG (reversed) Exonic
900176247 1:1292656-1292678 CTTCCCCAAAGGTGCCCGGCAGG - Exonic
900581660 1:3412636-3412658 CAGCCAAAACGGCGGCGGGCGGG + Exonic
901534279 1:9872317-9872339 CATGCACAGAGGCAGCAGGCAGG - Intronic
903332336 1:22602508-22602530 CCTCCATGAAGGCGGCCAGCCGG - Exonic
904808005 1:33145299-33145321 AATCCACAAAGCAGCCCGGCTGG - Intergenic
905899800 1:41574007-41574029 CCTCCAGAAAGGCAGCTGGCAGG - Intronic
911243344 1:95489397-95489419 CAACCACAAAGGCTGATGGCAGG - Intergenic
1063203423 10:3807634-3807656 CATCAGCAAAGGCAGCCAGCAGG - Intergenic
1063829840 10:9940240-9940262 CATCCACACAGGAGGCAGGGGGG + Intergenic
1064086423 10:12349390-12349412 CATCCCCGAAGGCGGCGCGCTGG + Intergenic
1066452887 10:35547689-35547711 CATCCACACAGGGCTCCGGCAGG - Intronic
1067280242 10:44865477-44865499 GATCCACAAAGGCTGCGGCCAGG + Intergenic
1069550625 10:69361338-69361360 CCTGCACAAAGGCTGCCAGCTGG + Intronic
1072416366 10:95249894-95249916 CTTCCCCAAATGCAGCCGGCCGG - Intronic
1076202915 10:128572695-128572717 CATCCACAGAGGTGGCCCACTGG + Intergenic
1083426706 11:62591803-62591825 CAGCCACAAAGGCCGGCGCCGGG + Intronic
1083427856 11:62598177-62598199 AATCCACATAGGCGGCGGGGAGG + Intronic
1084755490 11:71235895-71235917 CTTCAGCAAAGGCAGCCGGCAGG - Intronic
1088764375 11:112961996-112962018 CTTCCCCAAAGGCGGGCGGCGGG + Intronic
1089398004 11:118148395-118148417 GGTCCACAAAGGCCGCCGGAGGG + Intronic
1096566780 12:52488518-52488540 CATCAGCAATGGCGGCCTGCAGG + Exonic
1097284758 12:57868844-57868866 CATTCACAAGGGGGCCCGGCTGG + Intergenic
1100651194 12:96590838-96590860 TATTCACAAAGGCGTCCTGCTGG - Intronic
1108579431 13:51816097-51816119 CTTCCACATAGGGGGCGGGCTGG - Intergenic
1119767766 14:77201153-77201175 AATCCACAAAGGCTGCCTGGAGG - Intronic
1122995583 14:105262099-105262121 CACCCACACAGGAGCCCGGCAGG + Intronic
1129882480 15:79016517-79016539 CATCCACAACGGCTGCCAGGAGG + Intronic
1136632402 16:31496642-31496664 CAGCCACACAGGTGGCGGGCAGG + Intronic
1142002059 16:87669804-87669826 CATCCACACTGGCTGCCTGCAGG - Intronic
1143564230 17:7711932-7711954 CAACCACAAAAGCAGCCGTCAGG + Intergenic
1145992307 17:29086475-29086497 CATCCTCAATGGCAGCCTGCAGG + Exonic
1147350076 17:39835394-39835416 CATACACAATGGCGGCCTCCAGG + Intronic
1152737262 17:82003700-82003722 CATGCACAAAGGACGCAGGCGGG - Intronic
1156102309 18:33611613-33611635 CATCCACAAAAGCAGCAGACTGG - Intronic
1161518311 19:4709523-4709545 CATCCCCATGGGCGGCCGGACGG - Intronic
1163726304 19:18924948-18924970 CATCCACCGAGTCGGCCGGACGG + Exonic
1167382351 19:49146016-49146038 CCACCCCCAAGGCGGCCGGCAGG - Intronic
1168426757 19:56245326-56245348 CATTCACAGAGGAGGCCCGCTGG - Exonic
929087857 2:38186137-38186159 CATCCAAAAAGGCGTCAGCCAGG + Intergenic
937086549 2:119175638-119175660 CATCCTCACAGCCGGCTGGCAGG + Intergenic
946312947 2:218892926-218892948 CAACCGCAACGGCGGCCAGCTGG + Exonic
947836369 2:233178884-233178906 GAGCCACAAAGGTGGCCAGCGGG - Intronic
948194597 2:236085811-236085833 CCTTCACAAAGGAAGCCGGCTGG - Intronic
1170780045 20:19417076-19417098 CATACACAAAGGCCGATGGCAGG + Intronic
1179561791 21:42219918-42219940 CGCGCAGAAAGGCGGCCGGCAGG - Intronic
1181085210 22:20436651-20436673 CAGCCGCAGAGGCGGCCGCCGGG - Intronic
1185346521 22:50313009-50313031 CATCCTCAAGGGCGACTGGCTGG - Exonic
951620292 3:24594076-24594098 CATCCTCAAAGGCTGGAGGCAGG - Intergenic
967271784 3:187738685-187738707 CAGCCACAAAGGCCGCAGTCTGG + Intronic
983263028 4:165476882-165476904 GAGCCAGAAAGGCGGCAGGCTGG + Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
994355840 5:98793153-98793175 CATCCACAAAGGCGGCCGGCAGG - Exonic
997461425 5:134055139-134055161 CAGCCACAAAGGAGACAGGCTGG + Intergenic
1006575534 6:35042665-35042687 AGTCCACAAAGGGTGCCGGCAGG + Intronic
1016969541 6:149749622-149749644 CAGCCACAGGGGCGGGCGGCTGG + Exonic
1017622802 6:156316575-156316597 GATCCAGAAAGGCAGCCGACTGG + Intergenic
1017738243 6:157382002-157382024 CATCCACGAGGGCAGCCGGCTGG - Exonic
1019407086 7:889490-889512 CAGCCACAAAGGCAGCGGGAGGG + Intronic
1043082392 8:75783627-75783649 CAGCCACAGAGGCTTCCGGCTGG - Intergenic
1045485398 8:102627498-102627520 CATCCAGGAAGGCAGCAGGCTGG + Intergenic
1048335397 8:133498697-133498719 CAGCCACAGAGGAGCCCGGCAGG - Intronic
1052461405 9:28768224-28768246 CATCCACAAAGGTAACCAGCTGG + Intergenic
1062032306 9:134367225-134367247 GATCCACAAAGAAGGCAGGCAGG - Intronic
1200834695 Y:7721889-7721911 CTTCCAGAAAGGAGGCAGGCTGG - Intergenic