ID: 994356940

View in Genome Browser
Species Human (GRCh38)
Location 5:98803332-98803354
Sequence ATGTATAAACAGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994356934_994356940 20 Left 994356934 5:98803289-98803311 CCTATTTATTGTTTTGGGCCCAG No data
Right 994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG No data
994356935_994356940 2 Left 994356935 5:98803307-98803329 CCCAGAGAAGACAGTTGTGCCCA No data
Right 994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG No data
994356936_994356940 1 Left 994356936 5:98803308-98803330 CCAGAGAAGACAGTTGTGCCCAC No data
Right 994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994356940 Original CRISPR ATGTATAAACAGAAGAAGGA AGG Intergenic
No off target data available for this crispr