ID: 994357718

View in Genome Browser
Species Human (GRCh38)
Location 5:98812729-98812751
Sequence CATAGTGAACATAGTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994357718_994357720 8 Left 994357718 5:98812729-98812751 CCAACAACACTATGTTCACTATG No data
Right 994357720 5:98812760-98812782 AGTGAAAATATTTGGATCTGAGG No data
994357718_994357719 0 Left 994357718 5:98812729-98812751 CCAACAACACTATGTTCACTATG No data
Right 994357719 5:98812752-98812774 AGAAACTTAGTGAAAATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994357718 Original CRISPR CATAGTGAACATAGTGTTGT TGG (reversed) Intergenic
No off target data available for this crispr