ID: 994358916

View in Genome Browser
Species Human (GRCh38)
Location 5:98827819-98827841
Sequence ATGGCTCAGTGGTATGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994358911_994358916 25 Left 994358911 5:98827771-98827793 CCATGGTCTGACACTGTCAGTAA No data
Right 994358916 5:98827819-98827841 ATGGCTCAGTGGTATGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994358916 Original CRISPR ATGGCTCAGTGGTATGAGTA GGG Intergenic
No off target data available for this crispr