ID: 994359669

View in Genome Browser
Species Human (GRCh38)
Location 5:98836119-98836141
Sequence GACTGAAGAGTTTCAGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994359669_994359673 7 Left 994359669 5:98836119-98836141 CCTGATGCTGAAACTCTTCAGTC No data
Right 994359673 5:98836149-98836171 TAGACAGTTGGGAAAGAAGATGG No data
994359669_994359674 8 Left 994359669 5:98836119-98836141 CCTGATGCTGAAACTCTTCAGTC No data
Right 994359674 5:98836150-98836172 AGACAGTTGGGAAAGAAGATGGG No data
994359669_994359676 30 Left 994359669 5:98836119-98836141 CCTGATGCTGAAACTCTTCAGTC No data
Right 994359676 5:98836172-98836194 GTGTAAAGTGAGGAAGACCAAGG No data
994359669_994359675 20 Left 994359669 5:98836119-98836141 CCTGATGCTGAAACTCTTCAGTC No data
Right 994359675 5:98836162-98836184 AAGAAGATGGGTGTAAAGTGAGG No data
994359669_994359671 -4 Left 994359669 5:98836119-98836141 CCTGATGCTGAAACTCTTCAGTC No data
Right 994359671 5:98836138-98836160 AGTCCATACAGTAGACAGTTGGG No data
994359669_994359670 -5 Left 994359669 5:98836119-98836141 CCTGATGCTGAAACTCTTCAGTC No data
Right 994359670 5:98836137-98836159 CAGTCCATACAGTAGACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994359669 Original CRISPR GACTGAAGAGTTTCAGCATC AGG (reversed) Intergenic
No off target data available for this crispr