ID: 994371573

View in Genome Browser
Species Human (GRCh38)
Location 5:98973314-98973336
Sequence AAGAATGAGGAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994371568_994371573 22 Left 994371568 5:98973269-98973291 CCGAAGAAGGAGAAGGCAAAGAA No data
Right 994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG No data
994371567_994371573 26 Left 994371567 5:98973265-98973287 CCTGCCGAAGAAGGAGAAGGCAA No data
Right 994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG No data
994371566_994371573 27 Left 994371566 5:98973264-98973286 CCCTGCCGAAGAAGGAGAAGGCA No data
Right 994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994371573 Original CRISPR AAGAATGAGGAGAAGGAAGA AGG Intergenic
No off target data available for this crispr