ID: 994371842

View in Genome Browser
Species Human (GRCh38)
Location 5:98976519-98976541
Sequence GCTTCCATGAAGTGGCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994371842_994371846 18 Left 994371842 5:98976519-98976541 CCCTCAAGCCACTTCATGGAAGC No data
Right 994371846 5:98976560-98976582 TTTAGTGAGACCATAATTCAGGG No data
994371842_994371845 17 Left 994371842 5:98976519-98976541 CCCTCAAGCCACTTCATGGAAGC No data
Right 994371845 5:98976559-98976581 ATTTAGTGAGACCATAATTCAGG No data
994371842_994371847 27 Left 994371842 5:98976519-98976541 CCCTCAAGCCACTTCATGGAAGC No data
Right 994371847 5:98976569-98976591 ACCATAATTCAGGGATGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994371842 Original CRISPR GCTTCCATGAAGTGGCTTGA GGG (reversed) Intergenic
No off target data available for this crispr