ID: 994371990

View in Genome Browser
Species Human (GRCh38)
Location 5:98977960-98977982
Sequence GGGGGTAAACATATCTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994371990_994371997 19 Left 994371990 5:98977960-98977982 CCCTGTTAGATATGTTTACCCCC No data
Right 994371997 5:98978002-98978024 CTCACCTCACCCACTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994371990 Original CRISPR GGGGGTAAACATATCTAACA GGG (reversed) Intergenic
No off target data available for this crispr