ID: 994373696

View in Genome Browser
Species Human (GRCh38)
Location 5:98994790-98994812
Sequence GTCCATCTATTTCCTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994373694_994373696 15 Left 994373694 5:98994752-98994774 CCAGGGCTGGAGAACAAAAACAG No data
Right 994373696 5:98994790-98994812 GTCCATCTATTTCCTAGAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 81
994373693_994373696 23 Left 994373693 5:98994744-98994766 CCAATTTGCCAGGGCTGGAGAAC No data
Right 994373696 5:98994790-98994812 GTCCATCTATTTCCTAGAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 81
994373692_994373696 27 Left 994373692 5:98994740-98994762 CCATCCAATTTGCCAGGGCTGGA No data
Right 994373696 5:98994790-98994812 GTCCATCTATTTCCTAGAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994373696 Original CRISPR GTCCATCTATTTCCTAGAGC TGG Intergenic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
901177746 1:7317044-7317066 GTCCATCCAGTTCCAAGAACAGG - Intronic
902679157 1:18030891-18030913 GTCCTTCTATGTCCTGAAGCAGG - Intergenic
903969664 1:27110502-27110524 GACCATCTATTTCCCAGTCCAGG - Intronic
906644757 1:47466369-47466391 GTCACTCTATTCCCCAGAGCGGG + Intergenic
1065706492 10:28475786-28475808 GTCCATCTATCTGCTGGAGCTGG + Intergenic
1067163453 10:43846397-43846419 CTCCACCTCATTCCTAGAGCAGG + Intergenic
1071863786 10:89703329-89703351 GTCAATCTTTTTCCTTGATCAGG - Intronic
1073798904 10:107019723-107019745 GTACATTTATTTCCAACAGCAGG + Intronic
1074109191 10:110410576-110410598 GTCCTTTTCCTTCCTAGAGCAGG + Intergenic
1076462748 10:130657460-130657482 GTGGATCTATTTTCAAGAGCTGG + Intergenic
1080339660 11:31246629-31246651 TTCCAACTATTTCGTAAAGCTGG - Intronic
1083961237 11:66016108-66016130 GGTCATCTAAGTCCTAGAGCAGG + Intergenic
1084476713 11:69393605-69393627 GTCCATCTGTCTCCCATAGCTGG - Intergenic
1087411661 11:97798358-97798380 GTCAATCTATCTGCTGGAGCTGG - Intergenic
1094497899 12:31000442-31000464 GTCCAGCTTGTTCCTAGACCAGG - Intergenic
1094617571 12:32049616-32049638 GTCCATCTGTCTGCCAGAGCTGG + Intergenic
1108893896 13:55298386-55298408 GTCAGTCTATTTCCTAGAGGGGG - Intergenic
1110576036 13:77055931-77055953 GCCCATATTTTTCCAAGAGCAGG + Intronic
1111004115 13:82226407-82226429 GTCCATCTATCTCACACAGCAGG - Intergenic
1114552004 14:23538094-23538116 AAACATCTATTTCCTAGAACTGG + Intronic
1115445846 14:33488594-33488616 GTTCATCATATTCCTAGAGCTGG + Intronic
1116756510 14:48955357-48955379 GTCCCTCTATTGACTGGAGCTGG - Intergenic
1117619677 14:57572056-57572078 ATCCCTCTGTATCCTAGAGCAGG + Intronic
1118617847 14:67587160-67587182 GTCCATCCAGTTCCCACAGCTGG - Exonic
1123148548 14:106158324-106158346 GTCCAGCTCTGTCCTGGAGCTGG - Intergenic
1129733955 15:77949355-77949377 GTCCATCTCATTCCTTCAGCAGG - Intergenic
1132143948 15:99415738-99415760 GACTATGTATTTCCTATAGCTGG - Intergenic
1136624159 16:31451504-31451526 GTCCATATATTCCCTAGCTCTGG - Intergenic
1144954846 17:19013883-19013905 TTCCATCCATTTCTTAGAGAGGG - Intronic
1146600354 17:34209255-34209277 GTCCATCTATATGCTAGAGCTGG - Intergenic
1149465485 17:56875520-56875542 TGCCATCTTTTTCCTAGATCAGG + Intergenic
1149856929 17:60090802-60090824 GTCTTTCTATTCCCTAGAGCAGG + Intergenic
1151011390 17:70501739-70501761 GCCCACCTATTTCCAAGACCTGG + Intergenic
1152288829 17:79427285-79427307 GCCCCTCCATTCCCTAGAGCAGG - Intronic
1156511056 18:37637195-37637217 GTCCATCCATATCCTGGATCAGG + Intergenic
1157021883 18:43792946-43792968 GCCCATATAGTTCCTAGAGGTGG + Intergenic
1157519701 18:48337037-48337059 GTTGATCCACTTCCTAGAGCTGG + Intronic
1162492148 19:10999306-10999328 ATACATCTATTTCCCAGATCCGG - Intronic
1164188159 19:22890573-22890595 TTCCATCCATTTCCTAGAGATGG + Intergenic
928539196 2:32268277-32268299 GTACTTCTATTTCCTAAAGGAGG - Intergenic
929603664 2:43220344-43220366 CTCCATCTATTCCCTGGGGCTGG + Intergenic
940664406 2:156589984-156590006 GTCCCTCTACTTCCCAGAACAGG - Intronic
941136772 2:161727180-161727202 CTTCATCTTATTCCTAGAGCTGG + Intronic
945428910 2:209741223-209741245 GTTCATCTATTCCCTAGAACTGG - Intergenic
948997134 2:241587275-241587297 GTCCATCTGTTTGCTGGAGCTGG + Intronic
1169787142 20:9371022-9371044 GTCCCTCTGGTTCCCAGAGCTGG - Intronic
1170010476 20:11717254-11717276 GTCAATCTATCTGCTGGAGCTGG + Intergenic
1171967017 20:31538211-31538233 GTCCATGTATTTCTTCGTGCTGG + Exonic
1173645159 20:44628742-44628764 GGCCATCTATCTCCTAGTTCAGG - Intronic
1179713634 21:43276646-43276668 GTCCATGTATTCCCAAGAGCTGG + Intergenic
1180884221 22:19228535-19228557 GTACTTTTATTTCCTAGAGTTGG + Intronic
1184200907 22:42968745-42968767 GTCTATCAATGTCCTGGAGCTGG + Intronic
1185097403 22:48818840-48818862 GTTCATCTATTGCATTGAGCTGG + Intronic
952238330 3:31503545-31503567 GTCCAACTATTTTCTTGAGCTGG + Intergenic
953430723 3:42837560-42837582 ATCCATCTATCTGCTGGAGCTGG - Intronic
961112292 3:124295218-124295240 GACCATCTAATCCCCAGAGCAGG + Intronic
963448629 3:145447771-145447793 GTCAAGCTATTTTCTAGAGTGGG - Intergenic
967147443 3:186618097-186618119 TTCCACCTGTTTCATAGAGCAGG - Intronic
975103878 4:70546528-70546550 GACCATTTTTTCCCTAGAGCTGG - Intergenic
978623528 4:110658753-110658775 TAAGATCTATTTCCTAGAGCTGG + Intergenic
983375741 4:166925346-166925368 GTTCTACTATTTCTTAGAGCAGG - Intronic
984621728 4:181960968-181960990 AGCCATCTATTCCCTAGTGCAGG - Intergenic
990328931 5:54706235-54706257 TTCTATCTATTTCTTAGAGCTGG - Intergenic
994373696 5:98994790-98994812 GTCCATCTATTTCCTAGAGCTGG + Intergenic
997704908 5:135940166-135940188 GTATATTTATTTCCTAGAACAGG - Intronic
999130871 5:149282207-149282229 GTCCATCAATTCCCCAGAACTGG - Intronic
1000105631 5:158056342-158056364 GGCCAGCAATCTCCTAGAGCAGG + Intergenic
1008084477 6:47229684-47229706 GCCCAACTTTTTCCCAGAGCAGG + Intergenic
1009893933 6:69723298-69723320 GTCCATTTATTTTGTAGTGCAGG - Intronic
1012541852 6:100370395-100370417 GATCATCTATGTCCTAGTGCAGG - Intergenic
1014736825 6:125103540-125103562 GCACATTTATTTCCTAGAGCTGG + Intergenic
1016414595 6:143819672-143819694 GTCAATCTATCTACTGGAGCTGG - Intronic
1021578872 7:22130955-22130977 AACTATTTATTTCCTAGAGCAGG + Intronic
1022316437 7:29249355-29249377 GTCCATCTGTCTGCTGGAGCTGG - Intronic
1024459840 7:49648738-49648760 GTCAATCTATCTCCTGGAGCTGG + Intergenic
1027957682 7:84902403-84902425 GTCTATCTATCTTCTGGAGCTGG + Intergenic
1032677623 7:134145811-134145833 GAACATGCATTTCCTAGAGCGGG + Intronic
1033718284 7:144026313-144026335 CTCTCTCTCTTTCCTAGAGCTGG + Intergenic
1033852543 7:145515083-145515105 GACCATCTATGTACGAGAGCTGG - Intergenic
1034754483 7:153603301-153603323 GTCTATTTATTTCTAAGAGCTGG + Intergenic
1035112510 7:156495035-156495057 CACCTTGTATTTCCTAGAGCAGG + Intergenic
1036514750 8:9433506-9433528 GTCCCTCTATTTCCCCGGGCTGG - Intergenic
1050828895 9:9986246-9986268 GTCCAGTTATTTCCTAGATGTGG - Intronic
1050965683 9:11798462-11798484 ATACATTTATTTCTTAGAGCAGG - Intergenic
1052894421 9:33734101-33734123 GTGCCTCCATTTCCTAGACCTGG + Intergenic
1054736873 9:68762116-68762138 CTCCAGCTATTTCTTAAAGCTGG + Intronic
1060229855 9:121818588-121818610 TTCCATCTACTTCCAAGAACTGG - Intergenic
1187678110 X:21738503-21738525 TTCCTTCTATTTGCTAGAGGTGG + Intronic
1189385108 X:40530890-40530912 TTTCCTCTTTTTCCTAGAGCTGG + Intergenic
1191631567 X:63327487-63327509 GTCAATCTATTTGCTGAAGCTGG + Intergenic
1197720535 X:129742050-129742072 GACCAGCTAGTTCCTAGAGAGGG - Intronic
1201680763 Y:16641780-16641802 GGCCATCAATTAGCTAGAGCCGG + Intergenic