ID: 994374005

View in Genome Browser
Species Human (GRCh38)
Location 5:98997586-98997608
Sequence CCCGGCCAAGTCTCCATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994374005_994374020 29 Left 994374005 5:98997586-98997608 CCAAAAATGGAGACTTGGCCGGG No data
Right 994374020 5:98997638-98997660 CTTTGGGAGGCTGGGGCAGGCGG 0: 334
1: 26318
2: 79361
3: 159722
4: 170296
994374005_994374019 26 Left 994374005 5:98997586-98997608 CCAAAAATGGAGACTTGGCCGGG No data
Right 994374019 5:98997635-98997657 GAACTTTGGGAGGCTGGGGCAGG 0: 13
1: 1938
2: 68188
3: 188459
4: 241064
994374005_994374010 12 Left 994374005 5:98997586-98997608 CCAAAAATGGAGACTTGGCCGGG No data
Right 994374010 5:98997621-98997643 CACCTGTAATCCCAGAACTTTGG 0: 1535
1: 75870
2: 213055
3: 254444
4: 203232
994374005_994374013 16 Left 994374005 5:98997586-98997608 CCAAAAATGGAGACTTGGCCGGG No data
Right 994374013 5:98997625-98997647 TGTAATCCCAGAACTTTGGGAGG 0: 5803
1: 305562
2: 267520
3: 148957
4: 131267
994374005_994374017 22 Left 994374005 5:98997586-98997608 CCAAAAATGGAGACTTGGCCGGG No data
Right 994374017 5:98997631-98997653 CCCAGAACTTTGGGAGGCTGGGG 0: 1851
1: 92071
2: 214487
3: 238700
4: 264111
994374005_994374014 20 Left 994374005 5:98997586-98997608 CCAAAAATGGAGACTTGGCCGGG No data
Right 994374014 5:98997629-98997651 ATCCCAGAACTTTGGGAGGCTGG 0: 53
1: 3090
2: 3478
3: 2437
4: 2734
994374005_994374015 21 Left 994374005 5:98997586-98997608 CCAAAAATGGAGACTTGGCCGGG No data
Right 994374015 5:98997630-98997652 TCCCAGAACTTTGGGAGGCTGGG 0: 20
1: 1476
2: 5256
3: 5484
4: 6095
994374005_994374011 13 Left 994374005 5:98997586-98997608 CCAAAAATGGAGACTTGGCCGGG No data
Right 994374011 5:98997622-98997644 ACCTGTAATCCCAGAACTTTGGG 0: 1655
1: 81410
2: 314026
3: 244715
4: 145642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994374005 Original CRISPR CCCGGCCAAGTCTCCATTTT TGG (reversed) Intergenic
No off target data available for this crispr